Laboratorio de Referencia de Neumococos,
Centro Nacional de Microbiología, Instituto de Salud Carlos
III, Majadahonda E-28220, Madrid, Spain
Received 1 November 2000/Returned for modification 19 March
2001/Accepted 14 May 2001
The gene encoding the pneumococcal surface adhesin A (PsaA) protein
has been identified in three different viridans group streptococcal
species. Comparative studies of the psaA gene identified in
different pneumococcal isolates by sequencing PCR products showed a
high degree of conservation among these strains. PsaA is encoded by an
open reading frame of 930 bp. The analysis of this fragment in
Streptococcus mitis, Streptococcus oralis, and Streptococcus anginosus strains revealed a sequence
identity of 95, 94, and 90%, respectively, to the corresponding open
reading frame of the previously reported Streptococcus
pneumoniae serotype 6B strain. Our results confirm that
psaA is present and detectable in heterologous bacterial
species. The possible implications of these results for the suitability
and potential use of PsaA in the identification and diagnosis of
pneumococcal diseases are discussed.
 |
INTRODUCTION |
Streptococcus pneumoniae
infection is still a major cause of concern in human health. A recent
report of the World Health Organization concluded that the impact of
pneumococcal disease worldwide is similar to that of tuberculosis
(25). It has been emphasized that the development of an
improved pneumococcal vaccine is among the three vaccine priorities of
industrialized countries (5). The 23-valent
pneumococcal-polysaccharide vaccine provides only limited protection in
young children, immunocompromised individuals, and elderly people
(3, 6, 8, 14). Although the new polysaccharide-protein
conjugate vaccine appears to be efficient in these poor responder
groups, it will not protect against the capsular types of pneumococcal
strains not included in the formulation. A promising approach in
overcoming this problem is the use of third-generation vaccines
composed of species-specific pneumococcal protein(s), which may elicit
long-lasting, broadly protective T-cell-dependent immunity. One of
these proteins currently considered as a vaccine candidate is the
37-kDa protein PsaA (pneumococcal surface adhesin A). This protein was
first identified by Russell et al. (19) using monoclonal
antibodies (MAbs) and has attracted a great deal of interest in recent
years. Soon after the protein was identified, the psaA gene
was cloned and sequenced (23). Although the two first
psaA pneumococcal sequences reported from strains R36A and
D39 showed high heterogeneity (1), PCR-restriction fragment length polymorphism analysis showed that psaA is
highly conserved among the serotypes included in the 23-valent
polysaccharide vaccine (22). In the same study
(22), the authors sequenced a serotype 6B strain and
concluded that the psaA sequences from D39 and the serotype
6B strain most likely represented the S. pneumoniae
prototype sequences. More recently, Novak et al. reported that the
psaA gene from a serotype 4 strain was 99.6% identical to
the gene from strain D39 and 99.9% identical to the gene from the
serotype 6B strain (17). Morrison and coworkers confirmed the presence of psaA in all of the 90 S. pneumoniae serotypes by PCR analysis (16). The
specificity of the assay was proven by the lack of a similar signal
when analyzing heterologous bacterial species (n = 30)
and genera (n = 14), including the viridans group streptococci. This finding suggests that the psaA PCR assay
might be successfully used for the detection of pneumococci and
diagnosis of pneumococcal diseases (16).
The possible involvement of PsaA in the pathogenesis of pneumococcal
disease was indicated by immunization studies performed with purified
PsaA (24) and confirmed by insertion-duplication mutagenesis analysis of the psaA gene (1).
Recently, Briles et al. (2) observed that immunization
with PsaA reduces the carriage of pneumococci, suggesting that PsaA may
be useful for the elicitation of herd immunity in humans.
During the search for protein antigens that could elicit protective
immune responses against S. pneumoniae, we obtained an MAb
(F1-1B) which bound specifically to a 37-kDa protein. Molecular studies
have shown that MAb F1-1B binds to PsaA protein. We have also cloned
and sequenced psaA from the unencapsulated pneumococcal strain R6 and from one serotype 3 clinical isolate. Moreover, the
psaA gene has also been identified and sequenced in three viridans group streptococcal species: S. mitis, S. oralis,
and S. anginosus. Fifty clinical isolates of S. mitis and S. oralis showed positive hybridization with
a psaA probe. The demonstration of PsaA in heterologous
organisms suggests that the effectiveness of this antigen as a useful
diagnostic marker should be reconsidered.
 |
MATERIALS AND METHODS |
Bacterial strains.
The unencapsulated S. pneumoniae strain R6 was kindly provided by A. Tomasz (Rockefeller
University, New York, N.Y.), and S. pyogenes strain 746/96
was provided by J. A. Sáez-Nieto (Centro Nacional de
Microbiología, Madrid, Spain). Eleven strains of S. pneumoniae of serotypes 3, 4, 6, 9, 14, 15, 19, and 23 were taken
from our laboratory collection. The other Streptococcus strains were S. mitis NCTC 12261, S. oralis NCTC
11427, S. anginosus NCTC 10713, S. sanguinis NCTC
7863, S. thermophilus NCDO 573, S. bovis NCDO
597, and S. mutans NCTC 10449. The Neisseria
strains used were N. polysaccharea N 462, N. lactamica ATCC 10618, N. perflava ATCC 10555, N. cinerea ATCC 14685, and N. meningitidis C-11. We also
used Escherichia coli ATCC 25922. In addition, we analyzed
50 viridans group streptococci isolated from pharynx exudates, sputum,
and lower respiratory tract samples. These viridans group isolates were
identified as S. mitis and S. oralis with the
Rapid ID32 Strep system.
Protein analysis.
The MAb used in immunoblot analysis was
obtained by immunization of female BALB/c Jico mice (Criffa, Lyon,
France) with whole-cell suspensions of the S. pneumoniae
strain R6. Mice were immunized by one intraperitoneal injection per
week for 3 weeks, followed by an intravenous injection. The maximum
number of cells injected was 107. Fusion was carried out on
day 25 using standard procedures (4). Spleen cells from
three mice were fused with P3X63-Ag8.653 myeloma cells
(11). Supernatants of the growing hybridoma cultures were tested for antibodies against S. pneumoniae whole cells
using an enzyme-linked immunosorbent assay. Polystyrene microtiter
plates (Costar, Cambridge, Mass.) were coated with 50 µl of R6 cell
suspension diluted 1:200 in 0.1 M carbonate buffer, pH 9.6, and
incubated for 1 h at 37°C. After incubation, plates were blocked
with 100 µl of 1% (wt/vol) bovine serum albumin (Sigma, St. Louis
Mo.) in phosphate-buffered saline (PBS) for 1 h at 37°C and
washed three times with PBS supplemented with 0.05% Tween 20 (PBST), and antibodies (50 µl/well) were added. After overnight incubation at
4°C, plates were washed three times with PBST, and then horseradish peroxidase-conjugated goat anti-mouse immunoglobulin (Bio-Rad, Richmond, Calif.) in PBST was added. Plates were incubated (37°C, 30 min) and then washed five times with PBST, and 50 µl of
o-phenylenediamine (Sigma) (0.5 mg/ml in 0.2 M disodium
phosphate-0.1 M citric acid, pH 5.0, with 0.02% hydrogen peroxide)
was added. The reaction was terminated by the addition of 100 µl of 3 N H2SO4/well, and absorbance was determined at
492 nm.
The clone designated F1-1B was selected for future studies. The
sensitivity of the F1-1B MAb was tested with pneumococcal strains of
serotypes 3, 4, 6, 9, 14, 15, 19, and 23, using Western blot analysis.
Specificity was also analyzed using Western blot analysis with MAb
F1-1B on seven strains of viridans group streptococci, five strains of
Neisseria species, and one strain of E. coli.
DNA manipulations and sequencing.
Standard techniques were
used for the preparation and analysis of DNA (21). The
pCR2.1 plasmid (Invitrogen, Carlsbad, Calif.) was used for cloning. The
sequences of the primers used to amplify the psaA gene were
generated from the nucleic acid sequence data of psaA from
the serotype 6B strain. The sequences are 5'TCGCTCCCAAACAACGATAT3' (B7) for the forward primer and 5'CGACGTGTTTGAGTTGAGCA3'
(B10) for the reverse primer. PCR amplification generated a
1,300-bp fragment that included the whole psaA gene and the
first 217 nucleotides of psaD. The PCR fragments were
sequenced on both strands in an Applied Biosystems 377 DNA sequencer
using the dideoxynucleotide chain terminator method and appropriate
oligonucleotide primers. Sequencing at least two independent templates
eliminated possible errors that could have arisen from the PCR.
Hybridization with DNA probes.
The biotinylated PB710 probe
was generated by PCR using the B7 and B10 primers (see above). Probe
PP32 was obtained by PCR using S. pneumoniae R6 DNA as the
template and the forward primer P3 (5'AGGATCTAATGAAAAAATTAG3')
and the reverse primer P2 (5'GCCTTCTTTACCTTGTTCTGC3') used in the assay developed by Morrison and coworkers
(16). This probe included only the psaA gene
(930 bp). PCR was performed using biotinylated nucleotides, with
annealing taking place at 52°C for 1 min and extension at 72°C for
2 min for 25 cycles. Before hybridization, the gels were transferred to
nylon membranes using the capillary transfer method (21).
The resulting membranes were processed with the Phototope-Star
detection kit for nucleic acids (New England Biolabs) in accordance
with the manufacturer's recommendations. The molecular weights of the
hybridization signals were determined by comparison with a standard
molecular weight ladder.
Analysis of sequence data.
Sequence analysis was performed
with programs provided by the servers of the European Bioinformatics
Institute and the Swiss Institute of Bioinformatics.
Nucleotide sequence accession numbers.
The sequences in this
work have received the following EMBL accession numbers: S. pneumoniae strain R6, AF248230; S. pneumoniae type 3 strain 17912/93, AF248229; S. mitis NCTC 12261, AF248236; S. oralis NCTC 11427, AF248237; and S. anginosus
strain NCTC 10713, AF248235.
 |
RESULTS |
Analysis with MAb F1-1B.
Among the MAbs obtained after the
immunization of mice with strain R6, F1-1B bound to a 37-kDa protein
antigen of this strain. This MAb also reacted with seven pneumococcal
strains of different serotypes and, although with less intensity, with
two viridans group streptococcal species, i.e., S. mitis and
S. anginosus (Fig. 1). None of
the other heterologous bacterial species tested reacted with the MAb
(data not shown).

View larger version (75K):
[in this window]
[in a new window]
|
FIG. 1.
Western immunoblot analysis performed with the F1-1B MAb
to whole-cell antigen preparations. Lanes: 1, protein standards; 2, S. pneumoniae strain R6; 3, S. pneumoniae
serotype 3; 4, S. mitis; 5, S. anginosus. Numbers
on the left are molecular masses, in kilodaltons.
|
|
DNA analysis and comparative studies.
The size of the
recognized protein indicated that PsaA might be the antigen recognized
by the F1-1B MAb. In order to test this possibility, DNAs prepared from
R6, a serotype 3 strain, and eight reference streptococcal species that
belong to six different phylogenetic groups (9) were used
as the template in PCRs, with the B7 and B10 oligonucleotides as
primers. As expected, a 1.3-kb amplification product was recovered from
the sample containing DNA from R6, all the pneumococci, and two
streptococcal species (S. oralis and S. anginosus). A 1.4-kb DNA fragment from S. mitis was
also amplified. Direct sequencing of the PCR fragments from R6 and from
the serotype 3 strain revealed a 100% sequence homology with the
psaA gene from strain D39 and its flanking sequences and a
high degree of homology with other previously identified psaA genes: 90% for S. anginosus, 94% for
S. oralis, and 95% for S. mitis. The PCR product
from the reaction using R6 DNA was cloned in plasmid pCR2.1
(Invitrogen), and INV
F' cells were transformed with the recombinant
plasmid (pCRNB2). This process generated a recombinant plasmid
containing a 1.3-kb insert. Lysates of positive and negative clones
were used as antigens in Western blot analysis, and the F1-1B MAb bound
only to the positive clones (Fig. 2), confirming that F1-1B recognizes specifically the PsaA protein.

View larger version (68K):
[in this window]
[in a new window]
|
FIG. 2.
Western immunoblot of PsaA protein performed with the
F1-1B MAb. Lanes: 1, S. pneumoniae strain R6 whole-cell
antigen preparations; 2, protein standards; 3 and 4, lysates from two
clones of E. coli INV F' transformed with the vector
plasmid pCR2.1; 5 and 6, lysates from two clones of E. coli
INV F' harboring the recombinant plasmid pCRNB2. Numbers on the left
are molecular masses, in kilodaltons.
|
|
A comparison of the psaA-psaD intergenic regions is
presented in Fig. 3. Analysis of S. mitis DNA showed two different regions. The first 105 bp of the 3'
end of psaA had significant similarity (92% homology) with
pneumococcal boxes A and B and also with a sequence located downstream
of the pneumococcal glpF gene (15). Upstream of
box B, a 122-bp fragment sharing 94.3% homology with the
psaA-psaD intergenic region from R6 could be detected. The sequence of this intergenic space in S. oralis and S. anginosus revealed a high degree of conservation compared to the
corresponding fragment of strain R6 (120 and 122 bp with 79.7 and
76.4% homology, respectively).

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 3.
Schematic representation of the psaA-psaD
intergenic region in S. pneumoniae and in S. mitis. PCR direct sequencing of the psaA gene for
S. mitis revealed 95% identity with the corresponding open
reading frame of strain R6.
|
|
Comparison of the deduced amino acid sequences of PsaA among
streptococci.
Figure 4 shows an
alignment of the predicted type 3 PsaA protein sequence with those of
strain R6 and the three type strains of viridans group streptococcal
species. The sequence comparisons, using the SWISSPROT database and the
FASTA 3 program (18), revealed significant similarities
among them. Computed sequence homologies were 100% for PsaA from
S. pneumoniae (strains R6 and ST3) and 98% for the
pneumococcal PsaA and the homologous proteins from S. mitis, S. oralis, and S. anginosus.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 4.
Alignment of the deduced amino acid sequence of the PsaA
protein from strain R6 with those from S. pneumoniae
serotype 3, S. mitis, S. oralis, and S. anginosus. The putative signal peptidase II recognition site, the
LXXC domain, is in boldface. Amino acid residues identical to those of
R6 are indicated by hyphens.
|
|
Detection of the psaA gene in different viridans group
streptococcal strains.
To check whether the psaA gene
detected in the viridans group type strains was also present in
clinical isolates of these species, 50 strains of S. mitis
and S. oralis were analyzed. Genomic DNAs were digested with
HindIII and electrophoresed, and a Southern hybridization was performed using the PB710 probe. All the pneumococci and viridans group strains showed hybridization with this probe, which
includes the intergenic region between psaA-psaD and the first 217 nucleotides of psaD. To rule out a possible cross
hybridization due to homology with these sequences, we constructed the
PP32 probe. This probe recognized only the psaA gene. The
results with the PP32 probe were identical, indicating that the bands
corresponded to the psaA gene and not to the intergenic
sequences. The results of the Southern hybridization with the PP32
probe for pneumococci are shown in Fig.
5A, and the results for a representative
sample of viridans group streptococci are shown in Fig. 5B. While
pneumococci produced a unique band of hybridization of the same size,
heterogeneous patterns of hybridization were observed among viridans
group streptococci.

View larger version (95K):
[in this window]
[in a new window]
|
FIG. 5.
Identification of the psaA gene by DNA-DNA
hybridization. (A) Chromosomal DNAs from eight pneumococcal strains
(types 3, 4, 6, 9, 14, 15, 19, and 23). (B) Chromosomal DNAs from 12 viridans group streptococcal strains. DNAs were digested with
HindIII, electrophoresed, blotted, and hybridized with
the PP32 probe. As size standards, HindIII-digested DNA was used (lane 1); molecular sizes (in kilobases) are indicated on
the left.
|
|
 |
DISCUSSION |
A protein regarded as a pneumococcal vaccine candidate is
required to be well conserved among all of the different isolates and
should be species specific. Study results published until now seem to
confirm that PsaA fulfills these requirements and could be regarded as
a valid candidate for future vaccines. The results confirmed the
presence of the protein in all of the 90 pneumococcal serotypes and its
absence in all other streptococcal species. In this study, however, MAb
F1-1B, which recognizes PsaA protein, reacted with S. mitis
and S. anginosus strains as well and demonstrated that PsaA
is also present in these viridans group streptococcal species,
suggesting the ubiquity of this protein. Investigators have reported
proteins in viridans group streptococci and Enterococcus
faecalis that share common sequences with PsaA (12,
13). Some of these homologous proteins, such as ScaA from
S. gordonii, SsaB from S. sanguinis, FimA from
S. parasanguinis, and EfaA from E. faecalis, have
been cloned and sequenced. Comparison of their nucleotide sequences
with that of PsaA showed homology within the group that ranged from 57 to 82% (23). To rule out possible cross-reactions of
these homologous proteins with the F1-1B MAb we analyzed the generation
of amplification products in the viridans group streptococci. We found
that whereas samples from some species failed to be amplified using the
B7 and B10 psaA primers, S. mitis, S. oralis, and
S. anginosus DNAs were successfully amplified. When the
protein sequences of the amplification products of these species were
analyzed, 98% homology was found for each of the three viridans group
streptococcal species. Therefore, the presence of the psaA
gene has been demonstrated in the type strains of three viridans group
streptococcal species. Moreover, we have demonstrated by hybridization
methods that clinical isolates of S. mitis and S. oralis also contain this gene. The variability of hybridization
patterns observed among viridans group strains analyzed is in agreement
with the extensive diversity demonstrated within these species in
previous reports (9, 10).
In conclusion, we have demonstrated by Southern blotting and PCR
analysis that, in contrast to current opinion, the psaA gene is in fact present in heterologous organisms.
We thank J. Vázquez, R. López, and E. García
for stimulating discussions and critical reading of the manuscript. We
also thank J. A. Sáez-Nieto for kindly providing S. pyogenes strain 746/96 and F. Uruburu for providing the other
Streptococcus species strains (Spanish Type Culture Collection).
This research was supported by grant 96/0460 from Fondo de
Investigaciones Sanitarias (Ministerio de Sanidad y Consumo).
| 1.
|
Berry, A. M., and J. C. Paton.
1996.
Sequence heterogeneity of PsaA, a 37-kilodalton putative adhesin essential for virulence of Streptococcus pneumoniae.
Infect. Immun.
64:5255-5262[Abstract].
|
| 2.
|
Briles, D. E.,
E. Ades,
J. C. Paton,
J. S. Sampson,
G. M. Carlone,
R. C. Huebner,
A. Virolainen,
E. Swiatlo, and S. K. Hollingshead.
2000.
Intranasal immunization of mice with a mixture of the pneumococcal proteins PsaA and PspA is highly protective against nasopharyngeal carriage of Streptococcus pneumoniae.
Infect. Immun.
68:796-800[Abstract/Free Full Text].
|
| 3.
|
Butler, J. C.,
R. F. Breiman,
J. P. Campbell,
H. B. Lipman,
C. V. Broome, and R. R. Facklam.
1993.
Polysaccharide pneumococcal vaccine efficacy.
JAMA
270:1826-1831[Abstract].
|
| 4.
|
Clafin, L., and K. Williams.
1978.
Mouse myeloma-spleen cell hybrids: enhanced hybridization frequencies and rapid screening procedures.
Curr. Top. Microbiol. Immunol.
81:107-109[Medline].
|
| 5.
|
Cohen, J.
1994.
Bumps on the vaccine road.
Science
265:1371-1373[Free Full Text].
|
| 6.
|
Facklam, R. R., and R. F. Breiman.
1991.
Current trends in bacterial respiratory pathogens.
Am. J. Med.
91(Suppl. 6A):3S-11S[Medline].
|
| 7.
|
Fenoll, A.,
J. V. Martínez-Suárez,
R. Muñoz,
J. Casal, and J. L. García.
1990.
Identification of atypical strains of Streptococcus pneumoniae by a specific DNA probe.
Eur. J. Clin. Microbiol. Infect. Dis.
9:396-401[CrossRef][Medline].
|
| 8.
|
Kajhty, H., and J. Eskola.
1996.
New vaccines for the prevention of pneumococcal infections.
Emerg. Infect. Dis.
2:289-298[Medline].
|
| 9.
|
Kawamura, Y.,
X.-G. Hou,
F. Sultana,
H. Miura, and T. Ezaki.
1995.
Determination of 16S rRNA sequences of Streptococcus mitis and Streptococcus gordonii and phylogenetic relationships among members of the genus Streptococcus.
Int. J. Syst. Bacteriol.
45:406-408[CrossRef][Medline].
|
| 10.
|
Kawamura, Y.,
R. A. Whiley,
S.-E. Shu,
T. Ezaki, and J. M. Hardie.
1999.
Genetic approaches to the identification of the mitis group within the genus Streptococcus.
Microbiology
145:2605-2613[Abstract/Free Full Text].
|
| 11.
|
Kearney, J. F.,
A. Radbruch,
B. Liesegang, and K. Rajewsky.
1979.
A new mouse myeloma cell line which has lost immunoglobulin expression but permits the construction of antibody-secreting hybrid cell lines.
J. Immunol.
123:1548-1550[Abstract/Free Full Text].
|
| 12.
|
Kolenbrander, P. E.,
R. N. Andersen, and N. Ganeshkumar.
1994.
Nucleotide sequence of the Streptococcus gordonii PK488 coaggregation adhesin gene, scaA, and ATP-binding cassette.
Infect. Immun.
62:4469-4480[Abstract/Free Full Text].
|
| 13.
|
Lowe, A. M.,
P. A. Lambert, and A. W. Smith.
1995.
Cloning of an Enterococcus faecalis endocarditis antigen: homology with adhesins from some oral streptococci.
Infect. Immun.
63:703-706[Abstract].
|
| 14.
|
Mäkelä, P. H.,
M. Sibakov,
E. Herva, and J. Henrichsen.
1980.
Pneumococcal vaccine and otitis media.
Lancet
ii:547-551.
|
| 15.
|
Martin, B.,
O. Humbert,
M. Camara,
E. Guenzi,
J. Walker,
T. Mitchell,
P. Andrew,
M. Prudhomme,
G. Alloing,
R. Hakenbeck,
D. A. Morrison,
G. J. Boulnois, and J. P. Claverys.
1992.
A highly conserved repeated DNA element located in the chromosome of Streptococcus pneumoniae.
Nucleic Acids Res.
20:3479-3483[Abstract/Free Full Text].
|
| 16.
|
Morrison, K. E.,
D. Lake,
J. Crook,
G. M. Carlone,
E. Ades,
R. Facklam, and J. S. Sampson.
2000.
Confirmation of psaA in all 90 serotypes of Streptococcus pneumoniae by PCR and potential of this assay for identification and diagnosis.
J. Clin. Microbiol.
38:434-437[Abstract/Free Full Text].
|
| 17.
|
Novak, R.,
J. S. Braun,
E. Charpentier, and E. Tuomanen.
1998.
Penicillin tolerance genes of Streptococcus pneumoniae: the ABC-type manganese permease complex Psa.
Mol. Microbiol.
29:1285-1296[CrossRef][Medline].
|
| 18.
|
Pearson, W. R., and D. J. Lipman.
1988.
Improved tools for biological sequence comparison.
Proc. Natl. Acad. Sci. USA
85:2444-2448[Abstract/Free Full Text].
|
| 19.
|
Russell, H.,
J. A. Tharpe,
D. E. Wells,
E. H. White, and J. E. Johnson.
1990.
Monoclonal antibody recognizing a species-specific protein from Streptococcus pneumoniae.
J. Clin. Microbiol.
28:2191-2195[Abstract/Free Full Text].
|
| 20.
|
Saluja, S. K., and J. N. Weiser.
1995.
The genetic basis of colony opacity in Streptococcus pneumoniae: evidence for the effect of box elements on the frequency of phenotypic variation.
Mol. Microbiol.
16:215-227[CrossRef][Medline].
|
| 21.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 22.
|
Sampson, J. S.,
Z. Furlow,
A. M. Whitney,
D. Williams,
R. Facklam, and G. M. Carlone.
1997.
Limited diversity of Streptococcus pneumoniae psaA among pneumococcal vaccine serotypes.
Infect. Immun.
65:1967-1971[Abstract].
|
| 23.
|
Sampson, J. S.,
S. P. O'Connor,
A. R. Stinson,
J. A. Tharpe, and H. Russell.
1994.
Cloning and nucleotide sequence analysis of psaA, the Streptoccoccus pneumoniae gene encoding a 37-kilodalton protein homologous to previously reported Streptococcus sp. adhesins.
Infect. Immun.
62:319-324[Abstract/Free Full Text].
|
| 24.
|
Talkington, D. F.,
B. G. Brown,
J. A. Tharpe,
A. Koening, and H. Russell.
1996.
Protection of mice against fatal pneumococcal challenge by immunization with pneumococcal surface adhesin A (PsaA).
Microb. Pathog.
21:17-22[CrossRef][Medline].
|
| 25.
|
World Health Organization.
1996.
Investing in health research and development, a report of the Ad Hoc Committee on Health Research Relating to Future Intervention Options. TDR/Gen/96.1.
World Health Organization, Geneva, Switzerland.
|