Previous Article | Next Article ![]()
Clinical and Diagnostic Laboratory Immunology, November 2000, p. 967-976, Vol. 7, No. 6
Department of Biochemistry, Miyazaki Medical
College, Kiyotake, Miyazaki,1 Department
of Virology, School of Medicine, University of Tokushima, Kuramoto,
Tokushima,2 and AIDS Clinical
Center, International Medical Center of Japan, Toyama, Shinjuku,
Tokyo,3 Japan
Received 7 April 2000/Returned for modification 27 June
2000/Accepted 8 September 2000
An ultrasensitive enzyme immunoassay (immune complex transfer
enzyme immunoassay) of antibody immunoglobulin G (IgG) to human immunodeficiency virus type 1 (HIV-1) has been developed using recombinant HIV-1 reverse transcriptase (rRT) as antigen. However, some
disadvantages were noted in the use of rRT as antigen: rRT was produced
only with low efficiency in widely used strains of Escherichia
coli using a rather long DNA fragment (3,012 bp) of the whole
HIV-1 pol gene, and it was impossible to produce fusion proteins of RT for simple purification, since rRT is a heterodimer of
p66 and p51. In this study, recombinant HIV-1 p51 and p66 with Ser-Ser
at the N termini (Ser-Ser-rp51 and Ser-Ser-rp66) were produced in
E. coli as fusion proteins with maltose binding protein containing a factor Xa site between the two proteins and were purified
after digestion with factor Xa. Ser-Ser-rp51 was produced in larger
amounts and purified in higher yields with less polymerization than
Ser-Ser-rp66. Polymerized Ser-Ser-rp66 tended to be precipitated on
mercaptoacetylation for conjugation to Human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT), a heterodimer of p66 and p51 (p66
devoid of 120 C-terminal amino acids) (6, 28), has been
reported to be highly reactive with serum samples from
HIV-1-seropositive subjects. By conventional enzyme-linked
immunosorbent assay (ELISA) (5) and Western blotting (3), the seropositivity rate obtained with recombinant RT
(rRT) as antigen was higher than those obtained with gag
proteins (p17 and p24) and regulatory proteins (nef,
vif, and so on) as antigens and was as high as that obtained
with env gp41 as antigen. By a sandwich enzyme immunoassay
using rRT-coated microplates and rRT-alkaline phosphatase conjugate,
seroconversion was detected as early as by the conventional ELISA using
recombinant proteins (gp120, gp41, p24, p17, and p15) as antigens and
the gelatin particle agglutination test using a lysate of HIV-1 as
antigen (25). In addition, the specificity of immunoassays
using rRT as antigen appears to be fairly high. In a sandwich enzyme
immunoassay using rRT-coated microplates and rRT-alkaline phosphatase
for anti-HIV-1 antibodies, no reaction has been observed with sera from
subjects infected with either HIV-2 or hepatitis B virus
(25). RT of HIV has been reported to be antigenically
distinct from those of human T-lymphotropic virus type I (HTLV-I) and
HTLV-II (4), and no significant reaction has been observed
with serum samples from HTLV-I-infected subjects by the immune complex
transfer enzyme immunoassay (13).
Recently, an ultrasensitive enzyme immunoassay (immune complex transfer
enzyme immunoassay) for antibody immunoglobulin G (IgG) to HIV-1 using
rRT as antigen and This report describes the preparation of recombinant HIV-1 p51 and its
use as antigen in an immune complex transfer enzyme immunoassay of
antibody IgG to HIV-1 in comparison with those of recombinant HIV-1 p66
and rRT.
Enzymes and competent E. coli cells.
Recombinant
Taq DNA polymerase (TaKaRa Taq) and ligase were
obtained from Takara Shuzo Co., Kyoto, Japan. Restriction enzymes were
obtained from New England Biolabs, Inc., Beverly, Mass. Competent cells
of E. coli DH5 Construction of plasmids.
Plasmids for the production of
recombinant HIV-1 p66 (rp66) and p51 (rp51) were produced using HIV-1
p66 and p51 DNAs of pNL (i) pMALMBPSP2SP1Ser-Ser-p662121.
The plasmid for producing
a fusion protein of rp66 having Ser-Ser at the N terminus with maltose
binding protein (MBP) (MBP-Ser-Ser-rp66) was constructed so as to link
the two proteins with a spacer of 29 amino acids
(Asn-Ser-Ser-Ser-Asn-Ser-Asn-Thr-Ser-Ser-Asn-Asn-Asn-Pro-Ser-Ser-Ser-Asn-Asn-Asn-Pro-Ser-Ser-Ser-Ser-Ile-Glu-Gly-Arg) containing a factor Xa site to release Ser-Ser-rp66 from the fusion protein (Fig. 1 and
2). First, a DNA fragment (first spacer
DNA, SP1) containing SacI- and HindIII-split
sequences at the 5' and 3' ends, respectively; four restriction enzyme
sites in the order EcoRI, NheI, SalI,
and XbaI from the 5' to the 3' end; and the factor Xa site
between the NheI and SalI sites was produced by annealing two oligodeoxynucleotides
(5'-CGAATTCGAACGCTAGCTCGAGCATCGAAGGTCGACTGCAGTCTAGA and
5'-AGCTTCTAGACTGCAGTCGACCTTCGATGCTCGAGCTAGCGTTCGAATTCGAGCT) and was inserted into pMAL-c2 (New England Biolabs) after
digestion with SacI and HindIII
(pMALMBPSP1102). Second, HIV-1 p66 DNA was produced by PCR using
pNL
1071-412X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Recombinant p51 as Antigen in an Immune Complex
Transfer Enzyme Immunoassay of Immunoglobulin G Antibody to Human
Immunodeficiency Virus Type 1
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-D-galactosidase
(used as a label) and showed higher nonspecific and lower specific
signals in an immune complex transfer enzyme immunoassay of antibody
IgG to HIV-1 than Ser-Ser-rp51. The signals for serum samples of
HIV-1-seropositive subjects by immune complex transfer enzyme
immunoassay of antibody IgG to HIV-1 using Ser-Ser-rp51 as antigen
(Y) were well correlated to those obtained using rRT as
antigen (X) (log Y = 0.99 log
X + 0.23; r = 0.99). Thus, the use of
rp51 as antigen was advantageous over that of rp66 and rRT in an
immune complex transfer enzyme immunoassay of antibody IgG to HIV-1.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-D-galactosidase from Escherichia coli as label has been developed
(13). Antibody IgG to RT was allowed to react simultaneously
with 2,4-dinitrophenyl-bovine serum albumin-rRT conjugate and
rRT-
-D-galactosidase conjugate, and the immune complex
of the three components formed was trapped on polystyrene beads coated
with (anti-2,4-dinitrophenyl group) IgG. After washing, the immune
complex was transferred to polystyrene beads coated with (anti-human
IgG
-chain) IgG in the presence of
2,4-dinitrophenyl-L-lysine. By this enzyme immunoassay,
which was 300- to 1,000-fold more sensitive than Western blotting for p66 band, diagnosis and confirmation of HIV-1 infection using urine
(7, 8, 13), whole saliva (19, 20), and serum (9) have become more reliable than by previous methods.
Notably, diagnosis of HIV-1 infection was possible using even 1 µl of
whole saliva (19). However, the following disadvantages were
noted in the use of rRT as antigen. rRT had to be produced using a
rather long (3,012-bp) DNA fragment of the whole HIV-1 pol
gene (1, 26) and was not efficiently produced in widely used
strains of E. coli. In addition, it was impossible to
produce fusion proteins of RT for simple purification since rRT is a
heterodimer of p66 and p51, as described above.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
and BL21 were obtained from Life
Technologies, Rockville, Md., and Novagen Inc., Madison, Wis., respectively.
Bg lacking part of the env DNA
(2), which derived from pNL4-3 (1) constructed
from NY5 (GenBank accession no. HIVNL43 [M19921]) and LAV
(29). The sequences of p66 and p51 derived from NY5. Oligodeoxynucleotides used were obtained from BEX, Tokyo, Japan.
Bg as template and two primers
(5'-GCACCCGTCGACCCATTAGTCCTATTGAGA and
5'-GGTCTAGATCATAGTACTTTCCTGATTCCA) so as to have
SalI and XbaI sites at the 5' and 3' ends,
respectively, besides 1,680 bp (nucleotides 2,550 to 4,229)
corresponding to p66 and was inserted into pMALMBPSP1102 by treatment
with SalI and XbaI (pMALMBPSP1p662001). Third, a
DNA fragment (second spacer DNA, SP2) containing EcoRI- and
XbaI-split sequences at its 5' and 3' ends, respectively, was produced by annealing two oligodeoxynucleotides
(5'-AATTCGAACACTAGTTCCAACAACAATCCGTCTTCCAGCAACAACAACCCGT and
5'-CTAGACGGGTTGTTGTTGCTGGAAGACGGATTGTTGTTGGAACTAGTGTTCG)
and was inserted into pMALMBPSP1p662001 after digestion with
EcoRI and NheI (pMALMBPSP2SP1p662101).
Fourth, HIV-1 p66 DNA was prepared from pMBPSP2SP1p662101 by treatment
with SalI and HindIII and was inserted into
LITMUS 28 after treatment with XhoI and
HindIII (pLITp663). LITMUS 28 had a BsmBI
site overlapping the XhoI site (Fig. 2). Fifth, a DNA
fragment for addition of Ser-Ser at the N terminus of rp66 containing a
BamHI-split sequence at the 5' end, another BsmBI
site, and the complementary sequence at the 3' end to the
BsmBI-split sequence of pLITp663 was produced by annealing
of two oligodeoxynucleotides (5'-GATCCGTCTCATCGATCCTC and
5'-GGGTGAGGATCGATGAGACG) and was inserted into pLITp663
after digestion with BglII and BsmBI
(pLITSer-Ser-p667). Sixth, Ser-Ser-p66 DNA was prepared from
pLITSer-Ser-p667 by treatment with BsmBI and
HindIII and was inserted into pMALMBPSP2SP1p662101
after treatment with SalI and HindIII
(pMALMBPSP2SP1Ser-Ser-p662121).

View larger version (24K):
[in a new window]
FIG. 1.
Construction of plasmids for the production of
MBP-Ser-Ser-rp66.

View larger version (38K):
[in a new window]
FIG. 2.
Construction of pMALMBPSP2SP1SerSerp662121 from
pMALMBPSP2SP1p662101.
(ii) pMALMBPSP2SP1Ser-Ser-p513121.
The plasmid for producing
a fusion protein of rp51 with MBP (MBP-Ser-Ser-rp51) was constructed so
as to link the two proteins with a spacer of 31 amino acids including
two serine residues at the N terminus of rp51 as described above for
Ser-Ser-rp66 (Fig. 3). First, HIV-1 p51
DNA was produced by PCR using pNL
Bg as template and two primers
(5'-GCACCCGTCGACCCATTAGTCCTATTGAGA and
5'-GGTCTAGATTAGAAAGTTTCTGCTCCTATTA) so as to have
SalI and XbaI sites at the 5' and 3' ends,
respectively, besides 1,320 bp (nucleotides 2,550 to 3,869)
corresponding to p51. The DNA fragment was treated with SalI
and XbaI and inserted into a plasmid derived from pSE420
(Invitrogen, NV Leek, The Netherlands) to produce a fusion protein
containing a purification tag consisting of eight histidines and a
factor Xa site after digestion with SalI and SpeI
(pSEp51). SalI and SpeI sites in the plasmid were located in the appended polylinker sequence and the multiple cloning site derived from pSE420, respectively. Second, a DNA for the C
terminus of rp51 was prepared from pSEp51 by treatment with PstI and HindIII and inserted into
pMALMBPSP2SP1Ser-Ser-p662121 after treatment with the same enzymes
(pMALMBPSP2SP1Ser-Ser-p513121). The PstI site was located in
the common region of the p66 sequence in pMALMBPSP2SP1Ser-Ser-p662121
and the p51 sequence in pSEp51, and the HindIII site was
located in the multiple cloning sites of pMALMBPSP2SP1Ser-Ser-p662121
from pMAL-c2 and pSEp51 from pSE420.
|
Production of recombinant proteins.
Competent DH5
cells
were transformed with pMALMBPSP2SP1Ser-Ser-p662121 and were grown in
Luria-Bertani medium (27) containing penicillin G potassium
salt at 80 µg/ml at 25°C to an A600 of 0.6. Expression of MBP-Ser-Ser-rp66 was induced by addition of isopropyl-
-D-thiogalactopyranoside at a final
concentration of 0.3 mM. After induction at 25°C for 12 h, the
cultured cells were harvested by centrifugation at 4°C and
4,000 × g for 10 min and were washed by suspension in
900 ml of 10 mM Tris-HCl, pH 8.0, containing 0.1 M NaCl and 1 mM EDTA
and centrifugation at 4°C and 10,000 × g for 10 min.
The pelleted cells were stored at
20°C until use.
-D-thiogalactopyranoside at a final
concentration of 0.3 mM, the cultured cells were harvested, washed, and
stored at
20°C until use as described above.
Buffers. The frequently used buffers were 20 mM Tris-HCl, pH 7.4, containing 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride (Sigma, St. Louis, Mo.), pepstatin A (Peptide Institute Inc., Osaka, Japan) at 10 µg/ml, and E-64 (Peptide Institute Inc.) at 10 µg/ml (buffer A); 20 mM Tris-HCl, pH 8.0, containing 1 mM EDTA (buffer B); 20 mM Tris-HCl, pH 7.4, containing 1 mM EDTA (buffer C); 15 mM sodium phosphate buffer, pH 6.8, containing 0.1% Triton X-100 (polyethyene glycol mono-p-isooctylphenyl ether, specially prepared reagent for biochemical research; Nacalai Tesque, Kyoto, Japan) (buffer D); 10 mM sodium phosphate buffer, pH 7.5, containing 50 mM NaCl and 0.1% Triton X-100 (buffer E); 20 mM sodium phosphate buffer, pH 7.0, containing 0.1% Triton X-100 (buffer F); 0.1 M sodium phosphate buffer, pH 7.0, containing 0.01% Triton X-100 (buffer G); 50 mM sodium phosphate buffer, pH 6.8, containing 0.1% Triton X-100 (buffer H); 0.1 M sodium phosphate buffer, pH 6.0, containing 5 mM EDTA and 0.01% Triton X-100 (buffer I); and 10 mM sodium phosphate buffer, pH 7.0, containing 0.1 g of bovine serum albumin (fraction V; Intergen Co., Purchase, N.Y.) per liter, 1.0 mM MgCl2, and 1.0 g of NaN3 per liter (buffer J).
Purification of recombinant proteins. Purification was carried out at 4°C throughout, except for the final chromatography with Ultrogel AcA44 (Biosepra, Villeneuve la Garenne, France) at room temperature. Protein concentrations were determined with a bicinchoninic acid protein assay reagent kit (Pierce, Rockford, Ill.).
(i) Ser-Ser-rp66.
The cells from 18 liters of culture medium
were suspended in 900 ml of buffer A, sonicated, and centrifuged at
25,000 × g for 20 min. The supernatant fluid (920 ml)
was brought to 35% saturation of
(NH4)2SO4 by addition of solid
(NH4)2SO4 (192 g) and, after 20 min
of stirring, centrifuged at 25,000 × g for 20 min. The
supernatant fluid (1,000 ml) was brought to 60% saturation of
(NH4)2SO4 by addition of solid
(NH4)2SO4 (164 g) and, after 20 min
of stirring, centrifuged at 12,000 × g for 20 min. The precipitate between the 35 and 60% saturations was dissolved in 150 ml
of buffer B and dialyzed twice against 2 liters of buffer B overnight.
The dialysate (183 ml) was applied to a column (5.0 by 12.2 cm) of DEAE
Sepharose FF (Amersham Pharmacia Biotech, Buckinghamshire, England) in
buffer B. After washing, MBP-Ser-Ser-rp66 was eluted with a linear
gradient of 0 to 0.3 M NaCl in 250 ml of buffer B. The fractions
between 0.11 and 0.16 M NaCl (295 ml) were combined and brought to 60%
saturation of (NH4)2SO4 by addition of solid (NH4)2SO4 (115 g). The
precipitate was dissolved in 17 ml of buffer C and dialyzed three times
against 2 liters of buffer C overnight. The dialysate (19 ml) was
applied to a column (2.5 by 12 cm) of Amylose Resin (New England
Biolabs) in buffer C and, after washing with buffer C containing 0.2 M
NaCl, MBP-Ser-Ser-rp66 was eluted with buffer C containing 10 mM
maltose and 0.2 M NaCl and dialyzed against 2 liters of 50 mM Tris-HCl,
pH 8.0, containing 0.1 M NaCl overnight. The dialysate (17 ml, 38 mg of
protein) was incubated with a mixture of 168 µl of 10% Triton X-100
in water, 16.8 µl of 1 M CaCl2, and 282 µl of a 1-mg/ml
factor Xa solution (New England Biolabs) at 30°C for 5 h. After
removal of precipitates by centrifugation, the reaction mixture was
dialyzed against 2 liters of buffer D overnight. The dialysate (17 ml) was applied to a column (2.5 by 4.1 cm) of SP Sepharose FF (Amersham Pharmacia Biotech) in buffer D and, after washing with buffer D,
Ser-Ser-rp66 was eluted with a linear gradient of 0 to 0.5 M NaCl in
200 ml of buffer D. The fractions between 0.08 and 0.4 M NaCl (140 ml,
14 mg of protein) were combined and dialyzed twice against 2 liters of
buffer E overnight. The dialysate (141 ml) was applied to a column (1.5 by 2.8 cm) of rabbit (anti-MBP) IgG-Sepharose 4B in buffer E. The
flowthrough fractions (151 ml, 13 mg of protein) were applied to a
column (2.5 by 2.0 cm) of Affi-Gel heparin (Bio-Rad Laboratories,
Hercules, Calif.) in buffer E. After washing with buffer E,
Ser-Ser-rp66 was eluted with a linear gradient of 0.05 to 1 M NaCl in
100 ml of buffer E. The fractions between 0.1 and 0.6 M NaCl (54 ml,
7.6 mg of protein) were dialyzed twice against 2 liters of buffer F
overnight. The dialysate (50 ml) was applied to a column (1.5 by 2.8 cm) of Macro-Prep ceramic hydroxyapatite (type II, 20 µm; Bio-Rad
Laboratories) in buffer F and, after washing with buffer F,
Ser-Ser-rp66 was eluted with a linear gradient of 0.02 to 0.3 M
phosphate in 50 ml of buffer F. The fractions between 130 and 300 mM
phosphate (52 ml, 2.4 mg of protein) were combined and concentrated
with a Centricon-30 (Amicon Division W. R. Grace & Co., Beverly,
Mass.). The concentrated fractions (1.2 ml) were applied to a column
(1.5 by 58 cm) of Ultrogel AcA44 in buffer G. Fractions 48 to 59 (7.8 ml, Ser-Ser-rp66) were concentrated to 0.9 ml containing 1.0 mg of
protein and used for labeling with 2,4-dinitrophenyl groups and
-D-galactosidase.
(ii) Ser-Ser-rp51.
The cells from 18 liters of culture
medium were suspended in 720 ml of buffer A, sonicated, and centrifuged
as described above. The supernatant fluid (600 ml) was fractionated
between 30 and 50% (NH4)2SO4
saturation and dialyzed as described above. The dialysate (189 ml) was
applied to a column (5.0 by 18.3 cm) of DEAE Sepharose FF in buffer B. After washing with buffer B, MBP-Ser-Ser-rp51 was eluted with 450 ml of
buffer B containing 0.1 M NaCl. The eluate (125 ml) was applied to a
column (5.0 by 4.6 cm) of Amylose resin in buffer B. After washing with
buffer B containing 0.1 M NaCl, MBP-Ser-Ser-rp51 was eluted with buffer
B containing 10 mM maltose. The eluate (41 ml) was adjusted to a
concentration of 0.8 M (NH4)2SO4 by
addition of 4.3 g of solid
(NH4)2SO4 and was applied to a
column (2.5 by 6.0 cm) of butyl Sepharose 4B (Amersham Pharmacia
Biotech) in buffer B containing 0.8 M
(NH4)2SO4. After washing with
buffer B containing 0.8 M
(NH4)2SO4, MBP-Ser-Ser-rp51 was
eluted with 200 ml of buffer B containing 0.2 M
(NH4)2SO4. The eluate (44 ml)
containing 131 mg of protein was incubated with 440 µl of 10% Triton
X-100 in water and 500 µl of a 1-mg/ml factor Xa solution at 23°C
for 20 h. The reaction mixture was dialyzed against 2 liters of
buffer H overnight, and the dialysate (50 ml, 129 mg of protein) was
applied to a column (2.5 by 6.0 cm) of SP Sepharose FF in buffer H. After washing with buffer H, Ser-Ser-rp51 was eluted with 150 ml of
buffer H containing 0.3 M NaCl. The eluate (59 ml, 39 mg of protein)
was applied to a column (1.0 by 5.8 cm) of rabbit (anti-MBP)
IgG-Sepharose 4B in buffer E. The flowthrough fraction (60 ml) was
dialyzed twice against 2 liters of buffer H overnight, and the
dialysate (61 ml, 36 mg of protein) was applied to a column (2.5 by 3.1 cm) of Macro-Prep ceramic hydroxyapatite (type II, 20 µm) in buffer H. After washing with buffer H, Ser-Ser-rp51 was eluted with 150 ml of
0.2 M sodium phosphate buffer, pH 6.8, containing 0.1% Triton X-100
and 150 ml of 0.4 M sodium phosphate buffer, pH 6.8, containing 0.1%
Triton X-100. The eluate fractions (18 and 23 ml, 17 mg of protein)
were combined and concentrated with Centricon 30. The concentrated
fractions (1.1 ml) were applied to a column (1.5 by 56 cm) of Ultrogel
AcA44 in buffer G. Fractions 61 to 71 (11 ml) were concentrated to 1.7 ml containing 7.2 mg of protein with Centricon 30 and were used for
labeling with 2,4-dinitrophenyl groups and
-D-galactosidase.
Antibodies.
Rabbit (anti-2,4-dinitrophenyl-bovine serum
albumin) serum and rabbit anti-MBP serum were obtained from Shibayagi,
Gumma, Japan. Rabbit (anti-human IgG
-chain) IgG was obtained from
Medical and Biological Laboratories, Nagoya, Japan. IgG was prepared
from serum by fractionation with Na2SO4
followed by passage through a column of diethylaminoethyl cellulose
(17).
Coupling of proteins to Sepharose 4B. Rabbit (anti-MBP) IgG (10 mg), 2,4-dinitrophenyl-bovine serum albumin (10) (10 mg), and human IgG (10 mg) were coupled to 1.0 g of CNBr-activated Sepharose 4B (Amersham Pharmacia Biotech) in accordance with the manufacturer's instruction.
Affinity purification of antibodies.
Affinity-purified
(anti-2,4-dinitrophenyl-bovine serum albumin) IgG (22) and
(anti-human IgG
-chain) IgG (23) were prepared by elution
at pH 2.5 from columns of 2,4-dinitrophenyl-bovine serum
albumin-Sepharose 4B and human IgG-Sepharose 4B, respectively.
Coating of polystyrene beads with proteins.
Colored and
white polystyrene beads (3.2 mm in diameter; Immuno Chemical, Okayama,
Japan) were coated by physical adsorption with affinity-purified
(anti-2,4-dinitrophenyl-bovine serum albumin) IgG (0.1 g/liter) and
affinity-purified (anti-human IgG
-chain) IgG (0.1 g/liter),
respectively (18).
Labeling of recombinant proteins with 2,4-dinitrophenyl groups. Mercaptoacetyl-Ser-Ser-rp51. Ser-Ser-rp51 (0.84 mg, 16 nmol) in 1.0 ml of buffer G was incubated with 50 µl of 7.2 mM N-succinimidyl-S-acetylmercaptoacetate (Pierce) in N,N-dimethylformamide at 30°C for 30 min and was processed as described previously (14, 17). The average number of thiol groups introduced per Ser-Ser-rp51 molecule was 4.0 (17).
(i) 2,4-Dinitrophenyl-Ser-Ser-rp51 conjugate.
Mercaptoacetyl-Ser-Ser-rp51 (0.48 mg, 9.5 nmol) in 1.2 ml of buffer I
was incubated at 4°C for 20 h with
N-6-maleimidohexanoyl-
N-2,4-dinitrophenyl-L-lysine solution, which had been prepared by incubation of
N-2,4-dinitrophenyl-L-lysine hydrochloride
(Sigma) (0.18 mg, 0.46 µmol) in 91 µl of
N,N-dimethylformamide with 0.25 ml of 0.1 M
sodium phosphate buffer, pH 7.0, and
N-succinimidyl-6-maleimidohexanoate (Dojindo Laboratories,
Kumamoto, Japan) (0.12 mg, 0.38 µmol) in 38 µl of
N,N-dimethylformamide at 30°C for 30 min. The
reaction mixture was subjected to gel filtration on a Sephadex G-25
medium (Amersham Pharmacia Biotech) column (1.0 by 30 cm) in buffer G containing 0.1 M NaCl. The average number of 2,4-dinitrophenyl groups
introduced per Ser-Ser-rp51 molecule was 3.1 (10). Fractions containing the conjugate were stored at 4°C after addition of bovine
serum albumin (0.1 g/liter) and NaN3 (1 g/liter) until use.
(ii) 2,4-Dinitrophenyl-Ser-Ser-rp66 conjugate.
2,4-Dinitrophenyl-Ser-Ser-rp66 conjugate was prepared using
mercaptoacetyl-Ser-Ser-rp66 (0.24 mg, 3.7 nmol) and
N-6-maleimidohexanoyl-
N-2,4-dinitrophenyl-L-lysine solution (71 µg, 109 nmol) as described above. HIV-1 rRT, prepared as
described previously (26), was 2,4-dinitrophenylated using mercaptoacetyl-rRT (0.24 mg, 3.7 nmol) and
N-6-maleimidohexanoyl-
N-2,4-dinitrophenyl-L-lysine solution (48 µg, 74 nmol) as described above.
Labeling of recombinant proteins with
-D-galactosidase. (i)
Maleimide-
-D-galactosidase.
-D-Galactosidase from E. coli (Boehringer
Mannheim, Mannheim, Germany) was treated with 4,4'-dithiodipyridine and
N-succinimidyl-6-maleimidohexanoate as described previously
(14). The average number of maleimide groups introduced per
-D-galactosidase molecule was 2.7 (17).
(ii) Mercaptoacetyl-Ser-Ser-rp51. Ser-Ser-rp51 (2.8 mg, 55 nmol) in 2.8 ml of buffer G was incubated with 70 µl of 7.2 mM N-succinimidyl-S-acetylmercaptoacetate in N,N-dimethylformamide at 30°C for 30 min and was processed as described previously (14, 17). The average number of thiol groups introduced per Ser-Ser-rp51 molecule was 1.8 (17).
(iii) Ser-Ser-rp51-
-D-galactosidase
conjugate.
Mercaptoacetyl-Ser-Ser-rp51 (0.77 mg, 15 nmol) in 2 ml
of buffer I was incubated with
maleimide-
-D-galactosidase (2.4 mg, 4.4 nmol) in 0.2 ml
of buffer G at 4°C for 20 h. After incubation, the reaction
mixture was incubated with 22 µl of 0.1 M N-ethylmaleimide in buffer J at 30°C for 5 min and was subjected to gel filtration on
an Ultrogel AcA22 (Biosepra) column (1.5 by 60 cm) in buffer J
containing 0.1 M NaCl and 0.01% Triton X-100. Fractions containing the
conjugate were stored at 4°C until use. The average number of
Ser-Ser-rp51 molecules conjugated per
-D-galactosidase
molecule was 1.7 as calculated from the decrease in the number of
maleimide groups (17). The amount of conjugate was
calculated from
-D-galactosidase activity.
(iv) Ser-Ser-rp66-
-D-galactosidase and
rRT-
-D-galactosidase conjugates.
Ser-Ser-rp66-
-D-galactosidase and
rRT-
-D-galactosidase conjugates were prepared using
mercaptoacetyl-Ser-Ser-rp66 (0.15 mg, 2.3 nmol),
maleimide-
-D-galactosidase (0.27 mg, 0.5 nmol), mercaptoacetyl-rRT (0.44 mg, 7.0 nmol), and
maleimide-
-D-galactosidase (0.94 mg, 1.8 nmol) as
described above for Ser-Ser-rp51-
-D-galactosidase conjugate.
Immune complex transfer enzyme immunoassay of antibody IgG to
HIV-1.
Immune complex transfer enzyme immunoassay of antibody IgG
to HIV-1 was performed essentially in the same ways as described previously (11, 21). An aliquot (10 µl) of serum samples
was incubated with 140 µl of buffer J containing 0.4 M NaCl, 50 µg of inactive
-D-galactosidase (
-galactosidase-mutein;
Boehringer Mannheim), 100 fmol each of 2,4-dinitrophenyl-antigen and
antigen-
-D-galactosidase conjugate at room temperature
for 2 h. Inactive
-D-galactosidase was used to
eliminate interference by anti-
-D-galactosidase
antibodies (24). The reaction mixture was incubated for
1 h with two colored polystyrene beads coated with
affinity-purified (anti-2,4-dinitrophenyl group) IgG. The colored
polystyrene beads were washed twice by addition and aspiration of 2 ml
of buffer J containing 0.1 M NaCl and were incubated for 1 h with
two white polystyrene beads coated with affinity-purified (anti-human
IgG
-chain) IgG in 150 µl of buffer J containing 0.1 M NaCl and
1.0 mM
N-2,4-dinitrophenyl-L-lysine. The
incubations with polystyrene beads were performed with shaking at 180 rpm at room temperature throughout. After washing as described above,
-D-galactosidase activity bound to the white polystyrene beads was assayed at 30°C for 1 h by fluorometry using
4-methylumbelliferyl-
-D-galactoside as substrate
(16). The fluorescence intensity was measured relative to
10
8 M 4-methylumbelliferone in 0.1 M glycine-NaOH, pH
10.3, using 360 nm for excitation and 450 nm for emission analysis with
a spectrofluorophotometer (F-3010; Hitachi, Tokyo, Japan).
Western blotting. Western blotting was performed with a commercial kit preblotted with nine proteins of HIV-1 (gp160, gp120, p66, p55, p51, gp41, p31, p24, and p17 [HIV Western blot kit; Ortho Diagnostic Systems Inc., Raritan, N.J.]) (9).
Conventional ELISA. The conventional ELISA was performed with a commercial kit using five recombinant proteins of HIV-1 (gp120, gp41, p24, p17, and p15) as antigens (HTLV-III EIA; Abbott Laboratories, North Chicago, Ill.) (9).
Serum samples.
Serum samples were randomly collected from
200 HIV-1-seronegative subjects (152 males aged 34 to 63 years and 48 females aged 21 to 68 years) and 79 HIV-1-seropositive subjects (42 male asymptomatic carriers aged 17 to 47 years, 8 female asymptomatic
carriers aged 18 to 39 years, 7 male patients aged 10 to 52 years with
AIDS-related complex [ARC], 2 female patients aged 18 to 42 years
with ARC, and 20 male patients aged 14 to 61 years with AIDS) and were
stored at
20°C until use. Informed consents were obtained from all
of the subjects, and all of the serum samples were numbered and used anonymously. These serum samples were tested by gelatin particle agglutination test with a commercial kit (SERODIA-HIV; Fujirebio Inc.,
Tokyo, Japan) as described previously (12), and
seropositivity was confirmed by Western blotting using a commercial kit
(Ortho kit) (7).
| |
RESULTS |
|---|
|
|
|---|
Production and purification of recombinant HIV-1 proteins. In order to detect antibody IgG to HIV-1 RT (a heterodimer of p51 and p66), recombinant HIV-1 p51 and p66 with Ser-Ser at the N termini (Ser-Ser-rp51 and Ser-Ser-rp66) were produced as fusion proteins with MBP containing a factor Xa site between the two proteins in E. coli transformed with plasmids containing the corresponding DNAs and were purified from sonic extracts of the cells by successive processes of column chromatographies with DEAE Sepharose and Amylose resin, digestion with factor Xa, and column chromatographies with SP Sepharose, (anti-MBP) IgG-Sepharose, Affi-Gel heparin, hydroxyapatite, and Ultrogel AcA44.
Electrophoresis of sonic extracts indicated that MBP-Ser-Ser-rp51 was produced in much larger amounts per unit of culture medium volume than MBP-Ser-Ser-rp66. This was reflected in the fact that the amounts of MBP-Ser-Ser-rp51 and MBP-Ser-Ser-rp66 obtained from a column of Amylose resin were 215 and 44 mg, respectively (Table 1). The final yields of Ser-Ser-rp51 and Ser-Ser-rp66 from a culture medium volume of 18 liters which could be used for labeling with 2,4-dinitrophenyl groups and
-D-galactosidase were 7.2 and 1.0 mg (Peak II),
respectively (Table 1). In addition, Ser-Ser-rp66 was converted to a
mixture of almost equal amounts of Ser-Ser-rp66 and a smaller molecule,
probably Ser-Ser-rp51, during purification and was polymerized to
various extents in the eluate from a column of hydroxyapatite (Fig.
4). Polymerized Ser-Ser-rp66 tended to be
precipitated on mercaptoacetylation for conjugation to
-D-galactosidase.
|
|
Comparison of Ser-Ser-rp51 with Ser-Ser-rp66 and rRT as antigens by
immune complex transfer enzyme immunoassay.
Ser-Ser-rp51 was
compared with Ser-Ser-rp66 and rRT as antigens by immune complex
transfer enzyme immunoassay of antibody IgG to HIV-1 using
-D-galactosidase from E. coli as label. rRT was produced in E. coli transformed with a plasmid
containing the HIV-1 pol gene for protease, RT, and
integrase and was purified as described previously (26).
Serum samples (10 µl) were incubated with 2,4-dinitrophenyl-bovine
serum albumin-antigen conjugate and
antigen-
-D-galactosidase conjugate and subsequently
with colored polystyrene beads coated with affinity-purified
(anti-2,4-dinitrophenyl group) IgG to trap the immune complex of the
three components formed. After washing, the colored polystyrene beads
were incubated with 2,4-dinitrophenyl-L-lysine and white
polystyrene beads coated with affinity-purified (anti-human IgG
-chain) IgG to transfer the immune complex from the colored
polystyrene beads to the white ones.
-D-Galactosidase
activity bound to the white polystyrene beads was assayed by fluorometry.
(i) Dilution curves of two positive serum samples. When two serum samples from HIV-1-seropositive subjects serially diluted up to 107-fold with serum from an HIV-1-seronegative subject were tested, the dilution curves obtained by using Ser-Ser-rp51 as antigen were almost completely parallel with those obtained by using rRT. However, Ser-Ser-rp66 showed much higher nonspecific and lower specific signals than Ser-Ser-rp51. Therefore, Ser-Ser-rp66 was not used in the following experiments.
(ii) Positive and negative signals for more serum samples. The positive and negative signals were examined using serum samples from 79 HIV-1-seropositive subjects (50 asymptomatic carriers, 9 patients with ARC, and 20 patients with AIDS) and 200 HIV-1-seronegative subjects, respectively.
The positive signals obtained with Ser-Ser-rp51 as antigen (Y) were well correlated to those obtained with rRT as antigen (X) (log Y = 0.99 log X + 0.23; r = 0.99) (Fig. 5) and were up to 2.4-fold (1.6-fold, on average) higher than those obtained with rRT as antigen for 76 (96%) of the 79 seropositive subjects but equal or 1.2- to 1.7-fold lower for 3 seropositive subjects (4%) (Fig. 5 and 6). The negative signals obtained with Ser-Ser-rp51 (0.46 ± 0.34 [standard deviation]; range, 0 to 2.0) were not significantly different from those obtained with rRT (0.44 ± 0.34 [standard deviation]; range, 0 to 5.2). The lowest positive signals for the asymptomatic carriers and the patients with ARC and AIDS were 124,000-, 172,000-, and 13,000-fold, respectively, higher than the highest negative signal (Fig. 6). Namely, the sensitivity, specificity and, positive and negative predictive values were all 100% (Table 2).
|
|
|
Comparison of immune complex transfer enzyme immunoassays using Ser-Ser-rp51 and rRT as antigens with Western blotting. Two serum samples from HIV-1-seropositive subjects serially diluted with serum from an HIV-1-seronegative subject were tested by immune complex transfer enzyme immunoassay using Ser-Ser-rp51 as antigen and Western blotting (Ortho HIV Western Blot Kit) for p51 and p66 bands. The former was 1,000- to 6,000-fold more sensitive than the latter.
In addition, immune complex transfer enzyme immunoassays using Ser-Ser-rp51 and rRT as antigens were compared with Western blotting using the 79 serum samples from HIV-1-seropositive subjects and the 100 to 200 serum samples from HIV-1-seronegative subjects described above (Fig. 6 and Table 2). The detection rates of antibody IgG to gp160, gp41, p66, p51, p24, and p17 by Western blotting were 100, 99, 96, 90, 87, and 71%, respectively. The specificities and predictive values of Western blotting were less than 100% (82 to 99%), except that the specificity and positive predictive value for p66 band and the negative predictive values for gp160 and gp41 bands were 100%. In contrast, the detection rates of antibody IgG to HIV-1 by immune complex transfer enzyme immunoassays using Ser-Ser-rp51 and rRT as antigens and the specificities and predictive values of immune complex transfer enzyme immunoassays using Ser-Ser-rp51 and rRT were all 100%.Comparison of immune complex transfer enzyme immunoassay using Ser-Ser-rp51 as antigen with the conventional ELISA using five recombinant proteins as antigen. Immune complex transfer enzyme immunoassay with Ser-Ser-rp51 as antigen was compared with the conventional ELISA using five recombinant proteins (gp120, gp41, p24, p17, and p15) as antigens using the 79 serum samples from HIV-1-seropositive subjects and the 131 to 200 serum samples from HIV-1-seronegative subjects described above (Table 2). The sensitivity, specificity, and predictive values of the immune complex transfer enzyme immunoassay were all 100%. However, the specificity and positive predictive value of the conventional ELISA were 99%. Furthermore, the lowest signals for the seropositive subjects by immune complex transfer enzyme immunoassay and the conventional ELISA were 13,000- and 124-fold, respectively, higher than the highest signals for the seronegative subjects.
| |
DISCUSSION |
|---|
|
|
|---|
Both Ser-Ser-rp51 and Ser-Ser-rp66 were readily produced as fusion proteins with MBP for easy purification using short DNA fragments with 1,320 and 1,680 bp, respectively, while rRT had to be produced using a rather long DNA with 3,012 bp of the whole HIV-1 pol gene and could not be produced as a fusion protein with MBP due to the fact that RT is a heterodimer of p51 and p66 (1, 26). However, the use of Ser-Ser-rp51 as antigen in the enzyme immunoassay was advantageous over that of Ser-Ser-rp66 for the following reasons. Ser-Ser-rp51 was produced and purified in larger amounts (Table 1) and was much less polymerized (Fig. 4). In the immune complex transfer enzyme immunoassay, the conjugates of Ser-Ser-rp51 showed higher specific and lower nonspecific signals than those of Ser-Ser-rp66 and specific signals as high and nonspecific signals as low as those of rRT (Fig. 5 and 6).
The detection rate of antibody IgG to HIV-1 in 79 HIV-1-seropositive subjects by immune complex transfer enzyme immunoassay using Ser-Ser-rp51 as antigen was 100% (Fig. 6), while the detection rates of antibody IgGs to p51 and p66 by Western blotting in 79 HIV-1-seropositive subjects were 90 to 96% (both 96% in 50 asymptomatic carriers, both 100% in 9 patients with ARC, and 70% and 95%, respectively, in 20 patients with AIDS) (Table 2). This was consistent with a previous report that the detection rates of antibody IgG to HIV-1 by Western blotting for p51 and p66 bands were both 96% in asymptomatic carriers, 50 and 100%, respectively, in patients with ARC, and both 86% in patients with AIDS (15) and with the finding described above that the immune complex transfer enzyme immunoassay for antibody IgG to HIV-1 using Ser-Ser-rp51 as antigen was 1,000- to 6,000-fold more sensitive than Western blotting for p66 and p51 bands when two serially diluted serum samples from HIV-1-seropositive subjects were tested.
In the immune complex transfer enzyme immunoassay using Ser-Ser-rp51 alone as antigen, the difference between the lowest signal for 79 HIV-1-seropositive subjects and the highest signal for 200 HIV-1-seronegative subjects was 13,000-fold (Fig. 6), while the difference was only 124-fold in the conventional ELISA using no less than five recombinant proteins (gp120, gp41, p24, p17, and p15) as antigens. With the increase in the number of serum samples tested, the lowest signal for HIV-1-seropositive subjects tends to be further lowered and the highest signal for HIV-1-seronegative subjects tends to become higher. As a result, the number of false-positive, false-negative, and/or indeterminate results might increase. Therefore, false-positive, false-negative, and/or indeterminate results may be observed much less frequently in the immune complex transfer enzyme immunoassay using Ser-Ser-rp51 as antigen than in the conventional ELISA.
In summary, the use of Ser-Ser-rp51 as antigen was considered to be advantageous over the use of Ser-Ser-rp66 and rRT and the immune complex transfer enzyme immunoassay using Ser-Ser-rp51 as antigen seemed to be more competent for research and clinical purposes than Western blotting and the conventional ELISA.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Biochemistry, Miyazaki Medical College, Kiyotake, Miyazaki 889-1692, Japan. Phone: 81-985-85-0985. Fax: 81-985-85-2401.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Adachi, A.,
H. E. Gendelman,
S. Koenig,
T. Folks,
R. Willey,
A. Rabson, and M. A. Martin.
1986.
Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone.
J. Virol.
59:284-291 |
| 2. | Adachi, A., N. Ono, H. Sakai, K. Ogawa, R. Shibata, T. Kiyomasu, H. Masuike, and S. Ueda. 1991. Generation and characterization of the human immunodeficiency virus type 1 mutants. Arch. Virol. 117:45-58[CrossRef][Medline]. |
| 3. | Baur, A., R. Vornhagen, K. Korn, H. H. Sonneborn, B. Eberlein, T. Harrer, W. Brockhaus, and G. Jahn. 1992. Viral culture and p24 antigenemia of human immunodeficiency virus (HIV)-infected individuals correlated with antibody profiles determined with recombinant polypeptides of all HIV-1 open-reading frames. J. Infect. Dis. 165:419-426[Medline]. |
| 4. | Dalgleish, A., and R. A. Weiss. 1987. Human retroviruses, p. 517-543. In A. J. Zuckerman, J. E. Banatvala, and J. R. Pattison (ed.), Principles and practices of clinical virology. John Wiley & Sons, Inc., New York, N.Y. |
| 5. | Filice, G., L. Soldini, P. Orsolini, E. Razzini, R. Gulminetti, D. Campisi, L. Chiapparoli, E. Cattaneo, and G. Achilli. 1991. Sensitivity and specificity of anti-HIV ELISA employing recombinant (p24, p66, gp120) and synthetic (gp41) viral antigenic peptides. Microbiologica 14:185-194[CrossRef][Medline]. |
| 6. | Graves, M. C., M. C. Meidel, Y.-C. E. Pan, M. Manneberg, H.-W. Lahm, and F. Grüninger-Leitch. 1990. Identification of a human immunodeficiency virus-1 protease cleavage site within the 66,000 dalton subunit of reverse transcriptase. Biochem. Biophys. Res. Commun. 168:30-36[CrossRef][Medline]. |
| 7. | Hashida, S., K. Hirota, K. Hashinaka, A. Saitoh, A. Nakata, H. Shinagawa, S. Oka, K. Shimada, J. Mimaya, S. Matsushita, and E. Ishikawa. 1993. Detection of antibody IgG to HIV-1 in urine by sensitive enzyme immunoassay (immune complex transfer enzyme immunoassay) using recombinant proteins as antigens for diagnosis of HIV-1 infection. J. Clin. Lab. Anal. 7:353-364[Medline]. |
| 8. | Hashida, S., K. Hashinaka, A. Saitoh, A. Takamizawa, H. Shinagawa, S. Oka, K. Shimada, K. Hirota, T. Kohno, S. Ishikawa, and E. Ishikawa. 1994. Diagnosis of HIV-1 infection by detection of antibody IgG to HIV-1 in urine with ultrasensitive enzyme immunoassay (immune complex transfer enzyme immunoassay) using recombinant proteins as antigens. J. Clin. Lab. Anal. 8:237-246[Medline]. |
| 9. | Hashida, S., K. Hashinaka, I. Nishikata, S. Oka, K. Shimada, A. Saito, A. Takamizawa, H. Shinagawa, S. Yano, H. Kojima, T. Izumi, and E. Ishikawa. 1995. Immune complex transfer enzyme immunoassay that is more sensitive and specific than Western blotting for detection of antibody immunoglobulin G to human immunodeficiency virus type 1 in serum with recombinant pol and gag proteins as antigens. Clin. Diagn. Lab. Immunol. 2:535-541[Abstract]. |
| 10. |
Hashida, S.,
K. Tanaka,
N. Yamamoto,
T. Uno,
K. Yamaguchi, and E. Ishikawa.
1991.
Detection of one attomole of [Arg8]-vasopressin by novel noncompetitive enzyme immunoassay (hetero-two-site complex transfer enzyme immunoassay).
J. Biochem.
110:486-492 |
| 11. | Hashida, S., S. Ishikawa, K. Hashinaka, I. Nishikata, S. Oka, K. Shimada, A. Saito, A. Takamizawa, H. Shinagawa, and E. Ishikawa. 1998. Optimal conditions of immune complex transfer enzyme immunoassays for antibody IgGs to HIV-1 using recombinant p17, p24, and reverse transcriptase as antigens. J. Clin. Lab. Anal. 12:98-107[CrossRef][Medline]. |
| 12. | Hashida, S., K. Hashinaka, K. Hirota, A. Saitoh, A. Nakata, H. Shinagawa, S. Oka, K. Shimada, J. Mimaya, S. Matsushita, and E. Ishikawa. 1994. Detection of antibody IgG to HIV-1 in urine by ultrasensitive enzyme immunoassay (immune complex transfer enzyme immunoassay) using recombinant p24 as antigen for diagnosis of HIV-1 infection. J. Clin. Lab. Anal. 8:86-95[Medline]. |
| 13. |
Hashinaka, K.,
S. Hashida,
K. Hirota,
A. Saitoh,
A. Nakata,
H. Shinagawa,
S. Oka,
K. Shimada, and E. Ishikawa.
1994.
Detection of anti-human immunodeficiency virus type 1 (HIV-1) immunoglobulin G in urine by an ultrasensitive enzyme immunoassay (immune complex transfer enzyme immunoassay) with recombinant reverse transcriptase as an antigen.
J. Clin. Microbiol.
32:819-822 |
| 14. |
Hashinaka, K.,
S. Hashida,
A. Saitoh,
A. Nakata,
H. Shinagawa,
S. Oka,
K. Shimada, and E. Ishikawa.
1994.
Conjugation of recombinant reverse transcriptase of HIV-1 to -D-galactosidase from Escherichia coli for ultrasensitive enzyme immunoassay (immune complex transfer enzyme immunoassay) of anti-HIV-1 IgG.
J. Immunol. Methods
172:179-187[CrossRef][Medline].
|
| 15. | Holmström, P., S. Syrjänen, P. Laine, S.-L. Valle, and J. Suni. 1990. HIV antibodies in whole saliva detected by ELISA and Western blot assays. J. Med. Virol. 30:245-248[Medline]. |
| 16. |
Imagawa, M.,
S. Hashida,
Y. Ohta, and E. Ishikawa.
1984.
Evaluation of -D-galactosidase from Escherichia coli and horseradish peroxidase as labels by sandwich enzyme immunoassay technique.
Ann. Clin. Biochem.
21:310-317.
|
| 17. | Ishikawa, E., M. Imagawa, S. Hashida, S. Yoshitake, Y. Hamaguchi, and T. Ueno. 1983. Enzyme-labeling of antibodies and their fragments for enzyme immunoassay and immunohistochemical staining. J. Immunoassay 4:209-327[Medline]. |
| 18. | Ishikawa, E., and K. Kato. 1978. Ultrasensitive enzyme immunoassay. Scand. J. Immunol. 8(Suppl. 7):43-55. |
| 19. | Ishikawa, S., S. Hashida, K. Hashinaka, K. Hirota, A. Saitoh, A. Takamizawa, H. Shinagawa, S. Oka, K. Shimada, and E. Ishikawa. 1995. Diagnosis of HIV-1 infection with whole saliva by detection of antibody IgG to HIV-1 with ultrasensitive enzyme immunoassay using recombinant reverse transcriptase as antigen. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol. 10:41-47[CrossRef][Medline]. |
| 20. | Ishikawa, S., S. Hashida, K. Hashinaka, K. Hirota, M. Kojima, A. Saito, A. Takamizawa, H. Shinagawa, S. Oka, K. Shimada, and E. Ishikawa. 1996. Whole saliva dried on filter paper for diagnosis of HIV-1 infection by detection of antibody IgG to HIV-1 with ultrasensitive enzyme immunoassay using recombinant reverse transcriptase as antigen. J. Clin. Lab. Anal. 10:35-41[CrossRef][Medline]. |
| 21. | Ishikawa, S., S. Hashida, K. Hashinaka, M. Kojima, A. Saito, A. Takamizawa, H. Shinagawa, S. Oka, K. Shimada, and E. Ishikawa. 1997. More sensitive immune complex transfer enzyme immunoassay for antibody IgG to p17 of HIV-1 with shorter incubation time for immunoreactions and larger volumes of serum samples. J. Clin. Lab. Anal. 11:244-250[CrossRef][Medline]. |
| 22. | Kohno, T., T. Mitsukawa, S. Matsukura, and E. Ishikawa. 1988. Novel enzyme immunoassay (immune complex transfer enzyme immunoassay) for anti-thyroglobulin IgG in human serum. J. Clin. Lab. Anal. 2:209-214. |
| 23. | Kohno, T., E. Ishikawa, S. Sugiyama, S. Nakamura, and Y. Kanemura. 1987. A highly sensitive enzyme immunoassay of anti-insulin antibodies in human serum. J. Clin. Lab. Anal. 1:170-174. |
| 24. |
Kohno, T.,
H. Katsumaru,
H. Nakamoto,
T. Yasuda,
T. Mitsukawa,
S. Matsukura,
Y. Tsunetoshi, and E. Ishikawa.
1991.
Use of inactive -D-galactosidase for elimination of interference by anti- -D-galactosidase antibodies in immune complex transfer enzyme immunoassay for anti-thyroglobulin IgG in serum using -D-galactosidase from Escherichia coli as label.
J. Clin. Lab. Anal.
5:197-205[Medline].
|
| 25. | Loveday, C., and R. S. Tedder. 1993. Enzyme-linked immunosorbent assays for the measurement of human immunodeficiency virus, type 1 reverse transcriptase antigen and antibodies. J. Virol. Methods 41:181-192[CrossRef][Medline]. |
| 26. | Saitoh, A., H. Iwasaki, A. Nakata, A. Adachi, and H. Shinagawa. 1990. Overproduction of human immunodeficiency virus type I reverse transcriptase in Escherichia coli and purification of the enzyme. Microbiol. Immunol. 34:509-521[Medline]. |
| 27. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 28. |
Veronese, F. D. M.,
T. D. Copeland,
A. L. DeVico,
R. Rahman,
S. Oroszlan,
R. C. Gallo, and M. G. Sarngadharan.
1986.
Characterization of highly immunogenic p66/p51 as the reverse transcriptase of HTLV-III/LAV.
Science
231:1289-1291 |
| 29. | Wain-Hobson, W., P. Sonigo, O. Danos, S. Cole, and M. Alizon. 1985. Nucleotide sequence of the AIDS virus, LAV. Cell 40:9-17[CrossRef][Medline]. |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Antimicrob. Agents Chemother. | Clin. Microbiol. Rev. | Infect. Immun. |
|---|---|---|
| J. Clin. Microbiol. | J. Virol. | ALL ASM JOURNALS |