Previous Article | Next Article 
Clinical and Diagnostic Laboratory Immunology, September 2000, p. 835-839, Vol. 7, No. 5
1071-412X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
An IS711 Element Downstream of the
bp26 Gene Is a Specific Marker of Brucella spp.
Isolated from Marine Mammals
Axel
Cloeckaert,*
Maggy
Grayon, and
Olivier
Grepinet
Laboratoire de Pathologie Infectieuse et
Immunologie, Institut National de la Recherche Agronomique, 37380 Nouzilly, France
Received 23 March 2000/Returned for modification 22 May
2000/Accepted 6 June 2000
 |
ABSTRACT |
DNA polymorphism of the bp26 gene, coding for a
diagnostic protein antigen for brucellosis, was assessed by PCR and
restriction fragment length polymorphism analysis using primers to
amplify the bp26 gene with its flanking regions.
Surprisingly, whereas PCR performed on DNA of the reference strains of
the six recognized Brucella species produced a product of
the expected size (1,029 bp), PCR performed on DNA of three
representative strains from marine mammals (from a seal, a dolphin, and
a porpoise) produced a larger product, of about 1,900 bp. Nucleotide
sequencing of the 1,900-bp PCR products revealed the presence of an
insertion sequence, IS711, downstream of the
bp26 gene and adjacent to a Bru-RS1 element previously
described as being a hot spot for IS711 insertion. PCR
performed on a large number of field strains from different geographic
origins and from marine mammal isolates indicated that the occurrence
of an IS711 element downstream of the bp26 gene
was a feature specific to the marine mammal Brucella
strains. Thus, this PCR assay is able to differentiate
Brucella terrestrial isolates from marine mammal isolates
and could be applied for diagnostic purposes.
 |
TEXT |
Brucellae are gram-negative,
facultative, intracellular bacteria that can infect many species of
animals, as well as humans. Six species are recognized within the genus
Brucella: B. abortus, B. melitensis,
B. suis, B. ovis, B. canis, and
B. neotomae (8). This classification is mainly
based on differences in pathogenicity and host preference
(8). The main pathogenic species worldwide are B. abortus, which is responsible for bovine brucellosis, B. melitensis, the main etiologic agent of ovine and caprine
brucellosis; and B. suis, which is responsible for swine
brucellosis. These three Brucella species may cause abortion
in their hosts, which results in huge economic losses. B. ovis and B. canis are responsible for ram epididymitis
and canine brucellosis, respectively. For B. neotomae, only
strains isolated from desert rats have been reported. Distinction
between species and biovars is currently performed by differential
tests based on phenotypic characterization of lipopolysaccharide
antigens, phage typing, dye sensitivity, CO2 requirement,
H2S production, and metabolic properties (2).
Brucella strains have also been isolated from a great
variety of wildlife species, such as bison, elk, feral swine, wild
boars, foxes, hares, African buffalo, reindeer, and caribou
(9).
The broad spectrum of Brucella hosts has recently been
enlarged to include marine mammals. A number of recent reports have described the isolation and characterization of Brucella
strains from a wide variety of marine mammals, such as bottlenose
dolphins (Tursiops truncatus), common seals (Phoca
vitulina), harbor porpoises (Phocoena phocoena), common
dolphins (Delphinus delphis), Atlantic white-sided dolphins
(Lagenorhynchus acutus), striped dolphins (Stenella
caeruleoalba), hooded seals (Cystophora cristata), grey seals (Halichoerus grypus), a minke whale
(Balaenoptera acutorostrata), and an otter (Lutra
lutra) (3, 5, 10, 13, 18, 22). These strains were
identified as brucellae by their colonial and cell morphology, staining
characteristics, biochemical activity, agglutination by monospecific
antisera, susceptibility to lysis by a Brucella-specific
bacteriophage, and metabolic profiles. However, their overall
characteristics were not assimilable to those of any of the six
recognized Brucella species. Therefore, it was suggested
that they comprise a new species to be called B. maris based
on the current classification system (18).
It has been shown, on the basis of DNA-DNA hybridization studies, that
the genus Brucella is a highly homogeneous group (>90% DNA
homology for all species), and it has been proposed that this genus
should comprise only one genomic species (26).
Brucella strains isolated from marine mammals also fall into
this homogeneous group according to DNA-DNA hybridization
(25). Thus, several techniques have been employed to find
DNA polymorphisms which would enable the molecular typing of the
Brucella species and their different biovars (1, 4, 7,
11, 12, 14, 16, 17, 20, 21, 27).
The BP26 protein, also named Omp28, has been previously identified as
an immunodominant antigen in Brucella infections of cattle,
sheep, and humans (6, 19, 23). In the present study, DNA
polymorphisms of the bp26 gene, coding for this protein,
were assessed by PCR-restriction fragment length polymorphism analysis. Primers were designed to amplify the entire bp26 gene, with
its flanking regions, based on the bp26 nucleotide sequence
of B. melitensis 16M (GenBank accession no. U45996)
(6). The primers used were 26A (forward primer; 5'
GCCCCTGACATAACCCGCTT 3') and 26B (reverse primer; 5'
GAGCGTGACATTTGCCGATA 3'). PCR was performed on extracted DNAs as
described previously (7, 27). Briefly, amplification
reaction mixtures were prepared in volumes of 100 µl containing 10 mM
Tris-HCl (pH 9.0), 50 mM KCl, 1.5 mM MgCl2, 0.1% Triton
X-100 (1× PCR buffer; Promega, Charbonnieres, France), a 200 µM each
concentration of deoxynucleoside triphosphate, a 1 µM concentration
of each primer, 100 ng of genomic DNA, and 5 U of Taq DNA
polymerase (Promega). The temperature cycling for the amplification was
performed in a GeneAmp PCR system 9600 thermocycler (Perkin-Elmer) as
follows: cycle 1 was 94°C for 5 min (denaturation); the next 30 cycles were 58°C for 1 min (annealing), 70°C for 1 min 30 s
(extension), and 94°C for 1 min (denaturation); and the last cycle
was 58°C for 1 min (annealing) and 70°C for 10 min (extension). The
PCR products were run on 1% (wt/vol) agarose gels containing 0.5 µg
of ethidium bromide per ml.
Surprisingly, whereas PCR performed on DNA of the reference strains of
the six recognized Brucella species produced a product of
the expected size (1,029 bp), PCR performed on DNA of three representative strains from marine mammals (a seal, a dolphin, and a
porpoise) produced a larger product, of about 1,900 bp (Fig. 1). The nucleotide sequences of the
1,900-bp PCR products of the three marine Brucella strains
(B2/94, B1/94, and B14/94) were determined, and they revealed the
presence of an insertion sequence, IS711, downstream of the
bp26 gene (Fig. 2).
Interestingly, the IS711 element was found adjacent to a
Bru-RS1 element described as being a hot spot for IS711
insertion (15). Bru-RS1 is a repeated palindromic DNA
element of 103 bp which is highly conserved among brucellae and found
more than 35 times in the Brucella genome (15).
Such a Bru-RS1 element was previously described to occur downstream of
the bp26 gene of B. melitensis 16M
(19). Insertion of the IS711 element resulted in
duplication of the nucleotides TA (data not shown) at the target site,
as previously described for B. ovis (16). To
assess whether the occurrence of an IS711 element downstream
of the bp26 gene was specific to Brucella strains isolated from marine mammals, PCR with primers 26A and 26B was performed on a large number of field strains of Brucella
from different geographic origins and a large number of the recent isolates from different marine mammals (Tables
1 and
2). All terrestrial isolates, including
B. ovis strains for which a higher number of
IS711 copies have been described (16, 17, 21), showed a PCR profile in an agarose gel with a band of size of 1,029 bp,
whereas PCR on all marine mammal isolates showed the typical 1.9-kb
band, implying the presence of the IS711 element (data not
shown). The bp26 gene by itself, as shown by restriction fragment length polymorphism analysis with different restriction enzymes (AluI, ClaI, EcoRII,
EcoRV, HaeII, HaeIII,
HinfI, PstI, Sau3A, StyI,
and TaqI) and nucleotide sequencing, did not appear to be
useful for molecular typing purposes and thus must be rather conserved
among brucellae (data not shown). Only a few differences were observed
in the bp26 gene, and these were in B. abortus
strains (data not shown).

View larger version (71K):
[in this window]
[in a new window]
|
FIG. 1.
PCR-amplified bp26 gene using primers 26A and
26B of B. melitensis 16M (lane 2) and seal isolate B2/94
(lane 3) run on a 1% agarose gel. Lane 1, DNA
EcoRI/HindIII ladder (Appligene, Illkirch,
France).
|
|

View larger version (7K):
[in this window]
[in a new window]
|
FIG. 2.
Schematic view deduced from nucleotide sequencing of the
bp26 gene and flanking regions of B. melitensis
16M and seal isolate B2/94. Arrowheads indicate the locations of the
primers used for PCR.
|
|
IS711 elements, also known as IS6501
(21), have been described as useful targets for molecular
characterization of Brucella species and biovars based on
the number and distribution of IS711 copies within the
bacterial genomes (4, 16, 17, 21, 24). IS711-based fingerprints were described as stable, species
specific, and to some extent biovar specific. B. ovis has
been shown to carry a larger number of IS711 copies than the
other Brucella species (16, 17, 21). Recently, it
has been shown that Brucella strains isolated from marine
mammals have more copies of IS711 than all classical species
except B. ovis (3). Bricker et al. (3)
cloned one of these IS711 elements and its flanking regions to develop a PCR assay which would be specific for strains isolated from marine mammals. However, they obtained an amplification product of
the expected size for all marine mammal isolates and not for the
classical Brucella species and biovars, except for B. ovis. The PCR assay of our study with primers 26A and 26B,
although developed by chance, has the advantage of discriminating
between all terrestrial isolates, including B. ovis, and the
marine mammal isolates. This simple PCR assay could have several uses
in the future, such as possibly tracing these marine mammal strains if they are transmitted to livestock.
Nucleotide sequence accession numbers.
The nucleotide
sequences of the genes from bp26 to IS711 have
been deposited in GenBank under accession numbers AF242532, AF242533,
and AF242534.
 |
ACKNOWLEDGMENTS |
We thank G. Foster, B. Garin-Bastuji, and J. Godfroid for the gift
of the Brucella strains isolated from marine mammals. We are
grateful to J. M. Verger for helpful discussions.
 |
FOOTNOTES |
*
Corresponding author. Present address: Institut
National de la Recherche Agronomique, Station de Pathologie Aviaire et
Parasitologie, 37380 Nouzilly, France. Phone: (33) 2 47 42 77 50. Fax:
(33) 2 47 42 77 74. E-mail: cloeckae{at}tours.inra.fr.
 |
REFERENCES |
| 1.
|
Allardet-Servent, A.,
G. Bourg,
M. Ramuz,
M. Pages,
M. Bellis, and G. Roizes.
1988.
DNA polymorphism in strains of the genus Brucella.
J. Bacteriol.
170:4603-4607[Abstract/Free Full Text].
|
| 2.
|
Alton, G. G.,
L. M. Jones,
R. D. Angus, and J. M. Verger.
1988.
Techniques for the brucellosis laboratory.
Institut National de la Recherche Agronomique, Paris, France.
|
| 3.
|
Bricker, B. J.,
D. R. Ewalt,
A. P. MacMillan,
G. Foster, and S. Brew.
2000.
Molecular characterization of Brucella strains isolated from marine mammals.
J. Clin. Microbiol.
38:1258-1262[Abstract/Free Full Text].
|
| 4.
|
Bricker, B. J., and S. M. Halling.
1994.
Differentiation of Brucella abortus bv. 1, 2, and 4, Brucella melitensis, Brucella ovis, and Brucella suis bv. 1 by PCR.
J. Clin. Microbiol.
32:2660-2666[Abstract/Free Full Text].
|
| 5.
|
Clavareau, C.,
V. Wellemans,
K. Walravens,
M. Tryland,
J. M. Verger,
M. Grayon,
A. Cloeckaert,
J. J. Letesson, and J. Godfroid.
1998.
Phenotypic and molecular characterization of a Brucella strain isolated from a minke whale (Balaenoptera acutorostrata).
Microbiology
144:3267-3273[Abstract].
|
| 6.
|
Cloeckaert, A.,
H. Salih-Alj Debbarh,
N. Vizcaino,
E. Saman,
G. Dubray, and M. S. Zygmunt.
1996.
Cloning, nucleotide sequence, and expression of the Brucella melitensis bp26 gene coding for a protein immunogenic in infected sheep.
FEMS Microbiol. Lett.
140:139-144[CrossRef][Medline].
|
| 7.
|
Cloeckaert, A.,
J. M. Verger,
M. Grayon, and O. Grépinet.
1995.
Restriction site polymorphism of the genes encoding the major 25 kDa and 36 kDa outer-membrane proteins of Brucella.
Microbiology
141:2111-2121[Abstract].
|
| 8.
|
Corbel, M. J., and W. J. Brinley-Morgan.
1984.
Genus Brucella Meyer and Shaw 1920, 173AL, p. 377-388.
In
N. R. Krieg, and J. G. Holt (ed.), Bergey's manual of systematic bacteriology, vol. 1. Williams & Wilkins, Baltimore, Md.
|
| 9.
|
Davis, D. S.
1990.
Brucellosis in wildlife, p. 321-334.
. K. Nielsen and J. R. Duncan (ed.), Animal brucellosis. CRC Press, Boca Raton, Fla.
|
| 10.
|
Ewalt, D. R.,
J. B. Payeur,
B. M. Martin,
D. R. Cummins, and W. G. Miller.
1994.
Characteristics of a Brucella species from a bottlenose dolphin (Tursiops truncatus).
J. Vet. Diagn. Investig.
6:448-452[Abstract/Free Full Text].
|
| 11.
|
Fekete, A.,
J. A. Bantle,
S. M. Halling, and R. W. Stich.
1992.
Amplification fragment length polymorphism in Brucella strains by use of polymerase chain reaction with arbitrary primers.
J. Bacteriol.
174:7778-7783[Abstract/Free Full Text].
|
| 12.
|
Ficht, T. A.,
S. W. Bearden,
B. A. Sowa, and H. Marquis.
1990.
Genetic variation at the omp2 porin locus of the brucellae: species-specific markers.
Mol. Microbiol.
4:1135-1142[CrossRef][Medline].
|
| 13.
|
Foster, G.,
K. L. Jahans,
R. J. Reid, and H. M. Ross.
1996.
Isolation of Brucella species from cetaceans, seals and an otter.
Vet. Rec.
138:583-586[Abstract/Free Full Text].
|
| 14.
|
Grimont, F.,
J. M. Verger,
P. Cornelis,
J. Limet,
M. Lefèvre,
M. Grayon,
B. Régnault,
J. Van Broeck, and P. A. D. Grimont.
1992.
Molecular typing of Brucella with cloned DNA probes.
Res. Microbiol.
143:55-65[Medline].
|
| 15.
|
Halling, S. M., and B. J. Bricker.
1994.
Characterization and occurrence of two repeated palindromic DNA elements of Brucella spp.: Bru-RS1 and Bru-RS2.
Mol. Microbiol.
14:681-689[CrossRef][Medline].
|
| 16.
|
Halling, S. M.,
F. M. Tatum, and B. J. Bricker.
1993.
Sequence and characterization of an insertion sequence, IS711, from Brucella ovis.
Gene
133:123-127[CrossRef][Medline].
|
| 17.
|
Halling, S. M., and E. S. Zehr.
1990.
Polymorphism in Brucella spp. due to highly repeated DNA.
J. Bacteriol.
172:6637-6640[Abstract/Free Full Text].
|
| 18.
|
Jahans, K. L.,
G. Foster, and E. S. Broughton.
1997.
The characterisation of Brucella strains isolated from marine mammals.
Vet. Microbiol.
57:373-382[CrossRef][Medline].
|
| 19.
|
Lindler, L. E.,
T. L. Hadfield,
B. D. Tall,
N. J. Snellings,
F. A. Rubin,
L. L. Van De Verg,
D. Hoover, and R. L. Warren.
1996.
Cloning of a Brucella melitensis group 3 antigen gene encoding Omp28, a protein recognized by the humoral immune response during human brucellosis.
Infect. Immun.
64:2490-2499[Abstract].
|
| 20.
|
Mercier, E.,
E. Jumas-Bilak,
A. Allardet-Servent,
D. O'Callaghan, and M. Ramuz.
1996.
Polymorphism in Brucella strains detected by studying distribution of two short repetitive DNA elements.
J. Clin. Microbiol.
34:1299-1302[Abstract].
|
| 21.
|
Ouahrani, S.,
S. Michaux,
J. Sri Widada,
G. Bourg,
R. Tournebize,
M. Ramuz, and J. P. Liautard.
1993.
Identification and sequence analysis of IS6501, an insertion sequence in Brucella spp.: relationship between genomic structure and the number of IS6501 copies.
J. Gen. Microbiol.
139:3265-3273[Medline].
|
| 22.
|
Ross, H. M.,
K. L. Jahans,
A. P. MacMillan,
R. J. Reid,
P. M. Thompson, and G. Foster.
1996.
Brucella species infection in North Sea seal and cetacean populations.
Vet. Rec.
138:647-648[Free Full Text].
|
| 23.
|
Rossetti, O. L.,
A. I. Arese,
M. L. Boschiroli, and S. L. Cravero.
1996.
Cloning of Brucella abortus gene and characterization of expressed 26-kilodalton periplasmic protein: potential use for diagnosis.
J. Clin. Microbiol.
34:165-169[Abstract].
|
| 24.
|
Vemulapalli, R.,
J. R. McQuiston,
G. G. Schurig,
N. Sriranganathan,
S. M. Halling, and S. M. Boyle.
1999.
Identification of an IS711 element interrupting the wboA gene of Brucella abortus vaccine strain RB51 and a PCR assay to distinguish strain RB51 from other Brucella species and strains.
Clin. Diagn. Lab. Immunol.
6:760-764[Abstract/Free Full Text].
|
| 25.
| Verger, J. M., M. Grayon, A. Cloeckaert, M. Lefèvre, E. Ageron, and F. Grimont. Classification of
Brucella strains isolated from marine mammals using DNA-DNA
hybridization and ribotyping. Res. Microbiol., in press.
|
| 26.
|
Verger, J.-M.,
F. Grimont,
P. A. D. Grimont, and M. Grayon.
1985.
Brucella, a monospecific genus as shown by deoxyribonucleic acid hybridization.
Int. J. Syst. Bacteriol.
35:292-295[Abstract/Free Full Text].
|
| 27.
|
Vizcaino, N.,
J. M. Verger,
M. Grayon,
M. S. Zygmunt, and A. Cloeckaert.
1997.
DNA polymorphism at the omp-31 locus of Brucella spp.: evidence for a large deletion in Brucella abortus, and other species-specific markers.
Microbiology
143:2913-2921[Abstract].
|
Clinical and Diagnostic Laboratory Immunology, September 2000, p. 835-839, Vol. 7, No. 5
1071-412X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Dawson, C. E., Perrett, L. L., Stubberfield, E. J., Stack, J. A., Farrelly, S. S. J., Cooley, W. A., Davison, N. J., Quinney, S.
(2008). ISOLATION AND CHARACTERIZATION OF BRUCELLA FROM THE LUNGWORMS OF A HARBOR PORPOISE (PHOCOENA PHOCOENA). J Wildl Dis
44: 237-246
[Abstract]
[Full Text]
-
Neimanis, A. S., Koopman, H. N., Westgate, A. J., Nielsen, K., Leighton, F. A.
(2008). Evidence of Exposure to Brucella sp. in Harbor Porpoises (Phocoena phocoena) from the Bay of Fundy, Canada. J Wildl Dis
44: 480-485
[Abstract]
[Full Text]
-
Gee, J. E., De, B. K., Levett, P. N., Whitney, A. M., Novak, R. T., Popovic, T.
(2004). Use of 16S rRNA Gene Sequencing for Rapid Confirmatory Identification of Brucella Isolates. J. Clin. Microbiol.
42: 3649-3654
[Abstract]
[Full Text]
-
Bartosik, D., Sochacka, M., Baj, J.
(2003). Identification and Characterization of Transposable Elements of Paracoccus pantotrophus. J. Bacteriol.
185: 3753-3763
[Abstract]
[Full Text]