Received 7 May 1999/Returned for modification 30 July 1999/Accepted 18 August 1999
This study was conducted to produce a recombinant species-specific
oocyst wall protein of Cryptosporidium parvum. Antigens unique to C. parvum were identified by gradient sodium
dodecyl sulfate-polyacrylamide gel electrophoresis and immunoblotting of oocyst proteins from several different Cryptosporidium
species. Antiserum was then prepared against a 41-kDa antigen unique to C. parvum and used to identify a recombinant DNA clone,
designated rCP41. Expression of CP41 mRNA in C. parvum
oocysts was confirmed by reverse transcriptase PCR (RT-PCR). Although
the CP41 sequence was shown by PCR to be present in the genome of
C. baileyi, CP41 mRNA was not detected in this species by
RT-PCR. Immunofluorescence staining with antiserum against recombinant
CP41 detected native CP41 antigen on the surface of C. parvum oocysts but failed to detect CP41 on C. baileyi oocysts. Immunoelectron microscopy demonstrated that
native CP41 was distributed unevenly on the C. parvum
oocyst surface and was associated with amorphous oocyst wall material. In an enzyme-linked immunosorbent assay, purified rCP41 performed as
well as native C. parvum oocyst protein in measuring the
serological responses of young calves and adult cows to experimental
and natural C. parvum infections. These results indicate
that recombinant CP41 antigen may have potential in the immunodiagnosis
of cryptosporidiosis.
 |
INTRODUCTION |
The detection of
Cryptosporidium parvum oocysts in environmental samples
usually relies on one of three different techniques: vital-dye staining
(e.g., modified Ziehl-Neelsen acid-fast staining), direct or indirect
immunofluorescence assay (IFA), or enzyme immunoassay using
Cryptosporidium-reactive antibodies (Abs). Differences in the relative sensitivities of these assays have been noted (5, 6,
10, 14, 31). Confirmatory diagnosis of cryptosporidiosis in
patients is often carried out by assaying sera for specific C. parvum antigens (4, 24). Several low-molecular-weight C. parvum oocyst antigens, such as the 15-, 17-, and 23-kDa
proteins, appear to be useful for immunodiagnosis of
Cryptosporidium infection (26). The
immunogenicity of the 15-, 17-, and 23-kDa antigens and
somewhat-higher-Mr antigens (e.g., 32 and 47 kDa) has been observed in other mammalian species infected or immunized
with C. parvum oocysts (3, 20-23, 27-30, 32).
However, laboratory studies have shown that these immunodominant
antigens and other oocyst or sporozoite proteins are present in other
Cryptosporidium species (27, 33). This
cross-reactivity of immunodominant antigens may explain why commercial
Ab-based tests cannot differentiate C. parvum from species
of Cryptosporidium that are not infectious for humans. The
purpose of the present study was to identify a species-specific antigen
of C. parvum oocysts and obtain a DNA sequence encoding this
antigen for use in immunodiagnosis of human cryptosporidiosis.
 |
MATERIALS AND METHODS |
Parasites.
C. parvum (AUCP-1 strain) oocysts were
obtained by infecting a 1-day-old calf with 106 oocysts.
The calf was obtained at birth from the dairy herd at the Beltsville
Agricultural Research Center and housed in a 4- by 6-m concrete-floored
pen with cinder block walls in a sanitized masonry building. Feces were
collected from days 3 through 10 postinfection, pooled, and passed
through a series of sieves of increasingly finer mesh, ending with a
no. 325 mesh screen. Sieved fecal material was mixed with 2 M sucrose
and subjected to continuous-flow centrifugation (35)
followed by CsCl gradient centrifugation (15) for
purification of C. parvum oocysts. Clean oocysts were resuspended in distilled H2O, stored at 4°C, and used
from 1 to 6 months after collection, depending on the objectives of the experiment. Limited numbers of oocysts of other
Cryptosporidium species were obtained from outside sources;
the species were C. baileyi (B. Blagburn, Auburn
University), C. meleagridis (M. Levy, North Carolina State
University), C. serpentis (T. Graczyk, Johns Hopkins
University), and C. wrairi (C. E. Chrisp, University of Michigan, Ann Arbor).
Preparation of parasite nucleic acid and protein.
Cryptosporidium oocysts destined for RNA or DNA extraction
were treated for 30 min with 2.5% sodium hypochlorite (50% Clorox), washed five times with deionized H2O, resuspended in 1.0 ml
of deionized H2O, and immersed dropwise into a mortar
containing liquid nitrogen. The oocysts were ground in liquid nitrogen
to a fine powder and then transferred to a tube containing either RNA
or DNA extraction buffer. TRIZOL reagent was used to prepare total RNA
in accordance with the manufacturer's (Gibco-BRL, Gaithersburg, Md.)
directions. A high salt concentration step was incorporated, as per the
instructions of the manufacturer, to remove polysaccharide, which
appears to exist in large quantities in cryptosporidia (1). DNA was extracted by using proteinase K and sodium dodecyl sulfate (SDS) as previously described (11). RNA and DNA yields were estimated by optical density at 260 nm
(OD260)/OD280 readings. Total oocyst protein
was prepared by resuspending the parasites in protein extraction buffer
(10 mM Tris-HCl [pH 7.3], 1 mM MgCl2) containing
phenylmethylsulfonyl fluoride. The oocysts were subjected to five
freeze-thaw cycles, using dry ice-ethanol and 37°C water baths.
SDS-PAGE and immunoblotting of native and recombinant C. parvum protein.
Protein extracts of
Cryptosporidium oocysts were treated with sample buffer
containing 2-mercaptoethanol (19), heated for 3 min in a
boiling-water bath, fractionated by 7.5 to 15% gradient SDS-polyacrylamide gel electrophoresis (PAGE), and transblotted to an
Immobilon (Millipore, Bedford, Mass.) membrane as described previously
(11). The antigen-impregnated membranes were treated briefly
with phosphate-buffered saline (PBS), then immersed in PBS containing
2% nonfat dry milk (NFDM) to block nonspecific-Ab binding in
subsequent steps. After being subjected to blocking, the membranes were
incubated for 2 h with a 1:100 dilution of rabbit antiserum to
native or recombinant C. parvum antigen in PBS containing
0.05% Tween 20 (PBS-Tw20). The membranes were then probed for 2 h
with biotinylated goat anti-rabbit immunoglobulin G (IgG) (heavy and
light [H+L] chain specific; Vector Laboratories, Burlingame, Calif.);
this was followed by a 1-h incubation with avidin-peroxidase (Sigma
Chemical Co., St. Louis, Mo.) and a final treatment with peroxidase
substrate (0.5 mg of 4-chloro-1-naphthol/ml and 0.015%
H2O2 in PBS) to visualize Ab binding. The
membranes were washed with PBS-Tw20 three times between each incubation step.
Preparation of antiserum to C. parvum 41-kDa
protein.
Total oocyst protein extracted from C. parvum,
C. baileyi, C. meleagridis, and C. serpentis was electrophoresed in adjacent lanes of a 7.5 to 15%
gradient SDS-polyacrylamide gel (107 oocysts/lane) and
transblotted to a nitrocellulose membrane (Schleicher and Schuell,
Keene, N.H.). The blot was immunostained with rabbit antiserum raised
against total C. parvum oocyst protein to identify antigens
unique to C. parvum. A 41-kDa protein was identified, excised from adjacent unstained lanes, ground with a miniature mortar
and pestle, resuspended in PBS containing ImmunoMax SR adjuvant
(Zonagen, The Woodlands, Tex.), and used to immunize New Zealand White
rabbits (Covance, Denver, Pa.) by intramuscular injection. The rabbits
received subsequent booster immunizations 4 weeks after the primary
immunization and were then bled for serum by central auricular artery
puncture 2 weeks after the last booster immunization.
Immunoscreening of C. parvum genomic DNA libraries
for CP41 clones.
Genomic C. parvum DNA was subjected to
partial digestion with Tsp5901 restriction enzyme
(recognition site, AATT; New England BioLabs, Beverly, Mass.) to obtain
fragments approximately 1 kb in length. The DNA fragments were cloned
into the EcoRI site of the lambda Zap II bacteriophage
expression system (Stratagene, La Jolla, Calif.). Bacteriophages
containing C. parvum genomic DNA were screened at a density
of 104 plaques per petri dish, using the directions
supplied by the manufacturer (Stratagene). Nitrocellulose filters
soaked in 10 mM isopropyl-
-D-thiogalactopyranoside
(IPTG) were overlaid on the petri dishes containing phage plaques for
4 h at 37°C. The filters were washed with PBS, treated with
PBS-NFDM, and then probed with rabbit antiserum to native CP41 protein.
Ab binding was visualized as described above for immunoblotting.
Positive phages were picked and subjected to multiple rounds of
screening until a clonal population was obtained.
DNA sequencing.
Recombinant pBluescript plasmid DNA was
excised from recombinant lambda Zap bacteriophage by using an excision
protocol supplied by the manufacturer (Stratagene). The DNA sequence of
the recombinant pBluescript clone was obtained by using a
35S-dideoxy sequencing kit (Amersham-Pharmacia Biotech,
Piscataway, N.J.) and a PCR fluorescence dye terminator kit (Applied
Biosystems, Foster City, Calif.). The nonradioactive sequencing
reactions were analyzed on an ABI 373 sequencer (Applied Biosystems).
The complete DNA sequence was obtained by performing multiple reactions with both insert-specific and pBluescript-specific primers. Sequence compilation and identification of open reading frames (ORFs) for the
recombinant clones were performed by using the GCG sequence analysis
package (Genetics Computer Group, Madison, Wis.).
Production of recombinant polyhistidine proteins and immunization
of rabbits for production of antisera against recombinant protein.
The Cryptosporidium insert DNA was excised from pBluescript
by PstI and HindIII digestion and ligated
into the pTrcHis A vector (Invitrogen, Carlsbad, Calif.) cut with the
same restriction enzymes. Recombinant plasmid DNA was introduced into
Escherichia coli DH5 cells by standard transformation
procedures (7). Maintenance of the ORF between pTrcHis and
the insert DNA was confirmed by DNA sequencing. A time course study to
identify the time of IPTG induction leading to peak expression of
recombinant protein indicated that a 4-h induction was optimal. New
Zealand White rabbits (Covance) were immunized three times over a
2-month period with recombinant protein impregnated on nitrocellulose
paper which had been ground in a miniature mortar and pestle in a
manner similar to that described above. The rabbits were bled for serum
by central auricular artery puncture 2 weeks after the last booster immunization.
IFA and IEM.
C. parvum sporozoites were first excysted
by treating oocysts with 1% sodium hypochlorite (20% Clorox) for 10 min at room temperature, washing them five times with Hanks' balanced
salt solution (HBSS), resuspending them in HBSS, and incubating them for 1 h in a humidified chamber at 37°C in an atmosphere of 5% CO2. For examination by immunofluorescence microscopy, the
excysted oocyst-sporozoite mixture was pipetted onto multiwell glass
slides at a density of 104 oocysts per well (based on
pre-excystation counts) and allowed to air dry at room temperature
(RT). The parasites were then treated with PBS containing 1% bovine
serum albumin (PBS-BSA) for 1 h at room temperature prior to
incubation with a 1:100 dilution of antiserum in PBS-BSA for 2 h
at room temperature in a humidified chamber. Ab binding was detected by
treatment with fluorescein isothiocyanate-labeled anti-rabbit IgG (H+L
chain specific; Sigma Chemical Co.) for 1 h at room temperature in
a humidified chamber. The slides were washed after each incubation step
by three separate immersions in PBS. After the last incubation, each
slide was allowed to air dry prior to being overlaid with several drops
of VectaStain antibleaching mounting medium (Vector Laboratories) and a
coverslip. The C. parvum oocysts and sporozoites were
examined with an epifluorescence microscope.
For immunoelectron microscopy (IEM), the excysted sporozoite-oocyst
mixture was washed several times in PBS, enumerated on a hemocytometer,
aliquoted at 108 sporozoites per 1.5-ml microcentrifuge
tube, and pelleted by centrifugation. The oocyst-sporozoite pellet was
resuspended in 0.1 M sodium cacodylate containing 2% paraformaldehyde
and 0.5% glutaraldehyde for 20 min at room temperature. The fixed
parasites were washed twice with 0.1 M sodium cacodylate and pelleted
by centrifugation. The oocyst-sporozoite pellet was dehydrated in a
graded ethanol series, infiltrated overnight in LR White hard-grade acrylic resin (London Resin Company, London, England), and cured at
55°C for 24 h. Thin sections (90 nm thick) were obtained by using a Diatome diamond knife on a Reichert/AO Ultracut microtome and
collected on 200-mesh nickel grids. The grids were floated on drops of
PBS containing 0.1 M glycine and 1% BSA for 10 min, washed with PBS,
floated on drops of PBS-NFDM-Tw20, and floated on drops of PBS
containing a 1:100 dilution of normal goat serum. The grids were
incubated in a humidified chamber on drops containing a 1:100 dilution
of rabbit antiserum in PBS-NFDM-Tw20. The grids were incubated for
2 h at room temperature, washed three times with PBS-Tw20-NFDM,
and floated for 1 h at room temperature on drops of a 1:100
dilution of gold particle (10 nm diameter)-labeled goat anti-rabbit IgG
(H+L chain specific; Vector Laboratories). The grids were washed three
times with PBS-Tw20 and once with distilled water, air dried, stained
with 5% uranyl acetate for 30 min, and examined under a Hitachi H500H
transmission electron microscope at 75 kV.
RT-PCR analysis of C. parvum oocyst RNA.
C.
parvum oocysts stored for 1, 3, or 6 months at 4°C were analyzed
for the presence of CP41 mRNA by reverse transcriptase PCR (RT-PCR).
First-strand cDNA synthesis from 1 µg of total C. parvum RNA was carried out at 42°C in a reaction buffer
containing 20 U of Superscript II RT (Gibco-BRL) and either 2 pmol of a
gene-specific CP41-F1 primer (5' AGCATTAGTAGCAACAGTAG 3') or
4 pmol of oligo(dT) primer in a total volume of 20 µl as per the
manufacturer's (Gibco-BRL) directions. After RNase H treatment, PCR
was carried out with 2 µl of the first-strand reaction mixture, 0.25 U of Taq polymerase (Gibco-BRL), and 50 pmol (each) of
CP41-F1 and CP41-R1 (5' GAGATGGACTATTCTAGG 3') primers in a
final volume of 50 µl. Amplification was performed with a Stratagene
Robocycler, using the following PCR amplification protocol:
denaturation at 94°C for 1 min, annealing at 55°C for 1 min, and
extension at 72°C for 2 min for 30 cycles, followed by a final
extension at 72°C for 2 min. To analyze for the presence of the CP41
gene in genomic DNA, a single PCR was performed on DNA equivalent to
103 Cryptosporidium oocysts under reaction
conditions identical to those described above. The PCR products were
analyzed by PAGE, ethidium bromide staining, and UV transillumination
followed by capture to a charge-coupled device camera as described
previously (13).
ELISA.
Antisera were obtained weekly, beginning at 1 day of
age, for 7 to 10 weeks from four calves that had been given normal
bovine colostrum (NBC) at birth and were being housed in a dairy
operation that had experienced sporadic outbreaks of cryptosporidiosis
(natural infection). The calves were examined daily for diarrhea and
excretion of C. parvum oocysts in feces, using standard
methods. Antiserum was also obtained from a calf prior to, and every
week for 1 month after, being fed NBC at birth and inoculated per os
with 106 C. parvum oocysts (experimental
infection). Antisera were also obtained from adult cows (3 to 4 years
old) before and for several weeks after experimental C. parvum challenge and from two adult cows that had not been exposed
to C. parvum. Antisera were tested by enzyme-linked
immunosorbent assay (ELISA) for recognition of native C. parvum oocyst protein and recombinant CP41 antigen. In the former,
C. parvum oocysts were subjected to multiple freeze-thaw cycles and disruption on a Mini-Bead Beater (BioSpec Products, Bartlesville, Okla.) followed by centrifugation to pellet insoluble material. The oocyst protein supernatant (50 µl), equivalent to 4 × 104 oocysts (150 ng of protein), was pipetted
into individual wells of Immulon II microtiter plates (Dynex
Technologies, Inc., Chantilly, Va.) and incubated overnight at 4°C.
The native C. parvum protein ELISA was performed as
previously described (8). Titers are given as the reciprocal
of the highest dilution giving an absorbance reading twice that of the
average reading for the 1:80 dilution of the negative-control serum.
Recombinant CP41 polyhistidine fusion protein was purified by
denaturing Ni-nitrilotriacetic acid (NTA) affinity chromatography in
accordance with the manufacturer's (Invitrogen) directions. Eluates
containing peak amounts of purified protein, as indicated by SDS-PAGE
and immunoblotting, were pooled and adsorbed to the surface of Immulon
II microtiter plates as described above. The wells were washed with PBS
to remove unbound recombinant antigen and then treated with PBS
containing 2% normal horse serum (Sigma Chemical Co.) for 1 h at
room temperature to inhibit nonspecific-Ab binding in subsequent
incubation steps. The wells were washed with PBS-Tw20, and then the
plates were incubated for 2 h at room temperature with 100-µl
volumes of serial dilutions of positive-control bovine serum or a 1:100
dilution of negative-control bovine serum or sera from calves or cows
as described above. After the plates were washed three times with
PBS-Tw20, 100-µl volumes of a 1:1,000 dilution of peroxidase-labeled
goat anti-bovine IgG (H+L chain specific; Sigma Chemical Co.) were
added to the wells, and the plate was incubated for 1 h at room
temperature. The wells were washed three times with PBS-Tw20 prior to
addition of 50-µl aliquots of peroxidase substrate (0.01 mg of
o-phenylene diamine/ml and 0.001%
H2O2 in PBS) and a 10-min incubation at room
temperature. Color development was stopped by the addition of 50 µl
of 2% H2SO4 to each well. The absorbance at
492 nm was read on a Bio-Rad model 450 microplate reader. The titer of
anti-recombinant CP41 antigen Ab in serum was estimated through the use
of a standard curve generated with the positive-control serum by
previously described procedures (12).
Nucleotide sequence accession number.
The nucleotide
sequence of the rCP41 clone has been deposited in GenBank under
accession no. AF144621.
 |
RESULTS |
Antiserum raised against total C. parvum oocyst protein
recognized a number of antigens of C. parvum and C. baileyi (Fig. 1). A similar
recognition pattern was observed with C. meleagridis and
C. serpentis (data not shown). Although the majority of
antigens were common to all Cryptosporidium species, a few
antigens were unique to C. parvum. In particular, a 41-kDa
protein was present in C. parvum but not in the other
Cryptosporidium species (Fig. 1). A section of
nitrocellulose adjacent to the unique p41 antigen in an unlabeled
section of the blot was used to immunize rabbits for monospecific
antisera to the p41 protein. These antisera were used to identify a
recombinant bacteriophage clone encoding epitopes of the C. parvum 41-kDa antigen. DNA sequencing of this clone, designated
rCP41, revealed an insert of 740 nucleotides (nt) in length containing
an ORF that was in frame with beta-galactosidase of lambda
ZAP/pBluescript (Fig. 2). Two potential
ATG start sites were identified, one at nt 139 and the other at nt 196. Both sites conform to the Kozak consensus sequence for translation
initiation at the
3 and +4 nt position (18).

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 1.
Immunostaining of SDS-PAGE-fractionated native C. parvum (Cp) or C. baileyi (Cb) oocyst protein or
Ni-NTA-purified (P) and unpurified (IP) recombinant CP41 protein
(rCp41) with rabbit antiserum to whole C. parvum oocyst
protein (R CpOO) or to native (R NATIVE Cp41) or recombinant (R
RECOMBINANT Cp41) CP41 antigen or with normal control rabbit serum
(NRS). The positions of the 28-, 36-, and 41-kDa proteins are noted.
MrS, molecular weight standards.
|
|

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 2.
DNA sequence and predicted amino acid sequence of the
CP41 DNA clone isolated from C. parvum oocysts. Putative ATG
start sites are indicated in boldface.
|
|
Oligonucleotide primers (CP41R and CP41F) were prepared based on the
rCP41 DNA sequence and used in PCRs to amplify the respective sequence
in genomic DNAs from two C. parvum isolates, C. baileyi, and C. wrairi. An amplification product
similar in size to the insert DNA was observed, indicating that rCP41
was present in C. parvum (bovine and human isolates),
C. baileyi, and C. wrairi genomic DNAs (Fig.
3). RT-PCR of total RNA showed that the
CP41 transcript was present in C. parvum oocysts (Fig.
4). Although equivalent amounts of total
RNA were used in all reactions, the intensity of the RT-PCR signal
appeared to be inversely correlated with the age of the C. parvum oocysts. The RT-PCR signals derived from RNA isolated from
oocysts that had been stored at 4°C for 6 or 3 months were about 25 and 50%, respectively, of the signal from 1-month-old oocysts (Fig. 4,
lanes CP1+, CP2+, and CP3+, respectively). The control reactions in
which RT was not included did not show a PCR product, indicating that
the RT-PCR signal was due to the presence of mRNA rather than
contaminating DNA (Fig. 3, lanes CP1
, CP2
, and CP3
). In RT-PCR
assays on C. baileyi RNA, CP41 mRNA was not detectable (data
not shown). RT-PCR could not be performed on C. wrairi
because RNA from this species was not available. Attempts to identify
the transcript size for C. parvum by Northern blot
hybridization assay were unsuccessful.

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 3.
PCR amplification of the CP41 sequence from genomic DNA
(equivalent to 103 oocysts) of a bovine isolate of C. parvum (Cp bov), a human isolate of C. parvum (Cp hu),
C. baileyi (Cb), and C. wrairi (Cw). The
positions of x174 DNA standards are shown on the left.
|
|

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 4.
Molecular analysis of C. parvum for the
presence of the CP41 sequence in genomic DNA by PCR and for the
presence of CP41 mRNA in total RNA by RT-PCR. The PCR assay was
performed on DNA equivalent to 103 C. parvum
oocysts (CP DNA). RT-PCR was performed on total RNA equivalent to
5 × 105 C. parvum oocysts stored at 4°C
for 6 months (CP1), 3 months (CP2), or 1 month (CP3). +, Superscript
RTase added to first-step cDNA synthesis reaction; , no RT added to
first-step cDNA synthesis reaction. The positions of x174 DNA
standards are shown on the left.
|
|
The CP41 DNA sequence was inserted into the pTrcHis expression vector
to produce a recombinant polyhistidine-CP41 fusion protein. Immunoblots
of SDS-PAGE-fractionated protein extracts from E. coli
harboring the recombinant pTrcHis-CP41 plasmid contained two unique
protein bands, migrating at positions corresponding to 28 and 36 kDa,
produced 4 h after IPTG induction (Fig. 1). Protein extracts from
E. coli harboring the nonrecombinant pTrcHis plasmid
contained neither the 28- nor the 36-kDa recombinant protein (data not
shown). Purification of rCP41 by Ni-NTA affinity chromatography showed
that only the 36-kDa protein was isolated (Fig. 1). The 28- and 36-kDa
recombinant CP41 proteins were excised from unlabeled membranes and
subjected to N-terminal amino acid sequencing (Beckman Center, Stanford
University Medical Center, Palo Alto, Calif.). The 36-kDa protein
appeared to be the actual fusion protein containing pTrcHis-encoded
amino acids at its N terminus. The amino acid sequence of the
recombinant 28-kDa protein indicated that in E. coli,
translation also initiated from the CP41 start codon at nt 196. In an
immunoblotting assay, antiserum against the 36-kDa recombinant protein
recognized a native 41-kDa C. parvum antigen (Fig. 1). A
similar pattern was observed with antiserum against the 28-kDa
recombinant protein (data not shown). Antiserum raised against native
or recombinant CP41 antigen showed a similar pattern in immunoblots
with whole native C. parvum oocyst protein or with purified
or unpurified recombinant CP41 protein (Fig. 1, lanes Cp, P, and IP,
respectively). Normal control serum showed negligible recognition of
native C. parvum protein or purified recombinant CP41
antigen (Fig. 1). A band similar in size to the recombinant CP41
antigen was present in unpurified recombinant protein extracts and
recognized by normal control serum (Fig. 1).
The relationship between native and recombinant CP41 proteins was
unknown except for the fact that these antigens have at least one
epitope in common. The size discrepancy between the native CP41 protein
and either the 36-kDa or the 28-kDa recombinant CP41 protein did not
appear to be due to the presence of glycan residues on the native
protein. Glycosidase treatment was performed on total oocyst extracts
to determine if CP41 was glycosylated. In addition, untreated
SDS-PAGE-fractionated C. parvum protein impregnated on an
Immobilon membrane was treated with sodium perodiate to remove glycan
residues. No differences in molecular weight or immunoreaction
intensity were observed between the treated and untreated protein
samples (data not shown). The results indicated that native CP41
was not heavily glycosylated and that epitopes recognized by serum
against native or recombinant CP41 protein did not involve glycan moieties.
As shown by IFA, antiserum to native or recombinant CP41 antigen bound
a surface antigen of C. parvum oocysts (Fig.
5). Although not evident from the IFA
figures, the target antigen appeared to be distributed unevenly on the
surface of the oocyst. This surface location and distribution was
confirmed by IEM (Fig. 6). The antigen
was present on both external and internal regions of the oocyst wall
and was also associated with amorphous material on the oocyst outer
surface. Negligible staining of C. baileyi oocysts was
observed with antiserum to native or recombinant CP41 antigen (data not
shown).

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 5.
IFA staining of C. parvum oocysts with rabbit
antiserum prepared against native CP41 protein (A) or recombinant CP41
antigen (B) or with normal control rabbit serum (C).
|
|

View larger version (123K):
[in this window]
[in a new window]
|
FIG. 6.
IEM staining of C. parvum oocysts with rabbit
antiserum prepared against native CP41 protein (A) or recombinant CP41
antigen (B).
|
|
In the ELISA, recombinant CP41 antigen showed levels of binding similar
to those of the native C. parvum oocyst antigen when serum
from adult cows that were exposed to C. parvum was used as
the probe (Table 1). The preinfection
titers of Abs to the native and recombinant antigens were high and did
not appear to increase appreciably after experimental challenge.
Perhaps boosting of the Ab response was not observed because the oocyst
challenge did not result in patent infection due to the age-related
resistance of adult cows to C. parvum infection
(9). In young calves exposed to a natural C. parvum infection, titers of Abs to recombinant CP41 antigen were
high at the first postcolostral bleeding, possibly due to the presence
of anti-CP41 antibodies in normal colostrum, and then decreased (Fig.
7A to D). No increase in
titers of Ab to rCP41 was noted after exposure to C. parvum.
The titers of Ab to native C. parvum oocyst antigen were
variable. In two calves (Fig. 7B and D), the highest titers of Ab
against native antigen occurred at the time of oocyst shedding. In the
other two calves, peak anti-C. parvum antigen Ab titers were
observed immediately after colostrum feeding (Fig. 7A and C). A similar
pattern was observed after an experimental C. parvum
infection of a 1-day-old calf (Fig. 7E). Titers of Abs to rCP41 and
native C. parvum oocyst antigen were highest after colostrum
feeding and natural C. parvum oocyst inoculation (Fig. 7E).
Although anti-rCP41 Ab titers decreased with time, the response to
native C. parvum oocyst titers was variable (Fig. 7E).
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Anti-recombinant CP41 and anti-native C. parvum (nCP) oocyst antigen Ab titers in sera from adult cows
after experimental cryptosporidiosis infection or in unexposed
control adult cows
|
|





View larger version (76K):
[in this window]
[in a new window]
|
FIG. 7.
Serological titers of Abs against recombinant CP41 ( )
and native C. parvum oocyst protein ( ) in four calves (A
to D) exposed to a natural C. parvum infection and in
one calf (E) exposed to an experimental natural C. parvum
infection, as revealed by ELISA. The arrows indicates the first day of
C. parvum oocyst shedding.
|
|
 |
DISCUSSION |
This study represents initial stages in the development of
reagents for serodiagnosis of C. parvum infection and for
detecting this parasite in environmental samples. Although the CP41
gene sequence is present in the genome of Cryptosporidium
species that do not infect humans and calves (C. baileyi and
C. wrairi), RT-PCR and IFA (for C. baileyi)
indicated that CP41 is expressed only in C. parvum. It is
possible, however, that CP41 mRNA and/or CP41 oocyst antigen is less
stable in C. baileyi. Further testing of other C. baileyi isolates, C. wrairi, and other
Cryptosporidium species is required before it can be
concluded that CP41 is C. parvum specific. The results also
indicate that the CP41 primers used in the present study may be useful
for species-specific RT-PCR analysis of total
Cryptosporidium RNA but probably will not be useful for a
species-specific PCR test based on genomic DNA. The presence of CP41
antigen on the surface of C. parvum oocysts, as revealed by
IFA testing and IEM observations, indicates that polyclonal sera or
monoclonal antibodies to CP41 can be a valuable tools for
species-specific immunodetection of the parasite in environmental samples.
The differences in the apparent molecular masses of the recombinant
CP41 proteins (36 and 28 kDa) and the native C. parvum protein (41 kDa) do not appear to be due to the presence of glycan moieties on the native protein. Glycosidase treatment did not affect
the molecular weight of the native 41-kDa C. parvum protein. These findings were corroborated by experiments using sodium periodate. Perhaps rCP41 is not a full-length clone, i.e., is missing upstream and/or downstream coding sequences. The absence of a stop codon in the
DNA sequence supports this hypothesis. The predicted size of the
recombinant protein, based on the pTrcHis fusion peptide (4 kDa) and
the CP41 DNA sequence, is 31 kDa. The predicted size of the recombinant
protein initiating from the ATG at nt 196 is 19.5 kDa. The size
discrepancy between either the predicted size of the full-length fusion
protein (31 kDa) or the predicted truncated protein initiating at the
internal ATG start site (19.5 kDa) and the observed 36- and 28-kDa
recombinant proteins may be due to any of several phenomena. One is the
observed aberrant migration of E. coli-expressed recombinant
proteins during SDS-PAGE for proteins with atypical amino acid
compositions (1a, 16, 17, 34). The CP41 amino acid sequence
contains a disproportionate number of Asn (21%) and Thr (11%)
residues, representing almost one-third of the total. The recombinant
protein initiating from the internal ATG start site contains even
higher percentages of Asn (27%) and Thr (14%).
The ELISA data suggest that natural C. parvum infections in
young calves do not elicit a strong Ab response against the 41-kDa protein. It is unclear whether the high anti-rCP41 Ab titers observed in the experimental infection were due to the presence of anti-C. parvum antibodies in NBC or were stimulated by the C. parvum oocyst inoculation. These observations are consistent with
other studies showing that natural and experimental C. parvum infections in young calves elicit a strong serological Ab
response to a single low-Mr protein but much
weaker Ab responses to other antigens, including the 41-kDa protein
(20, 23, 25, 32, 36). The immunoblotting data reported by
others, and our unpublished observations during experiments using sera
from C. parvum-infected calves (natural and experimental
infections), are in contrast with the finding of one study, that calves
infected with the parasite exhibit high titers of Abs to a
wide-Mr range of C. parvum oocyst
antigens (29). The present study also showed high titers of
Abs to native and recombinant C. parvum antigen in adult
cows previously exposed to the parasite. Similar to the findings of
others, adult cows with high anti-C. parvum Ab titers are
resistant to challenge infection, neither exhibiting clinical signs of
cryptosporidiosis nor shedding C. parvum oocysts in feces
(2, 9). The absence of patent infection may explain why
titers against native oocyst antigen or recombinant CP41 antigen did
not appreciably increase after C. parvum challenge. The
ELISA data also indicated that NBC has Ab to the C. parvum
41-kDa protein because serum from calves fed colostrum contained high
anti-rCP41 titers at 1 week of age.
| 1.
| Abrahamsen, M. Personal communication.
|
| 1a.
|
Alano, P.,
S. Premawansa,
M. C. Bruce, and R. Carter.
1991.
A stage specific gene expressed at the onset of gametocytogenesis in Plasmodium falciparum.
Mol. Biochem. Parasitol.
46:81-88[Medline].
|
| 2.
|
Casemore, D. P.,
S. E. Wright, and R. L. Coop.
1997.
Cryptosporidiosis human and animal epidemiology, p. 65-92.
In
R. Fayer (ed.), Cryptosporidium and cryptosporidiosis. CRC Press, Boca Raton, Fla
|
| 3.
|
Enriquez, F. J., and M. W. Riggs.
1998.
Role of immunoglobulin A monoclonal antibodies against P23 in controlling murine Cryptosporidium parvum infection.
Infect. Immun.
66:4469-4473[Abstract/Free Full Text].
|
| 4.
|
Frost, F. J.,
A. A. de la Cruz,
D. M. Moss,
M. Curry, and R. L. Calderon.
1998.
Comparisons of ELISA and Western blot assays for detection of Cryptosporidium antibody.
Epidemiol. Infect.
121:205-211[Medline].
|
| 5.
|
Garcia, L. S., and R. Y. Shimizu.
1997.
Evaluation of nine immunoassay kits (enzyme immunoassay and direct fluorescence) for detection of Giardia lamblia and Cryptosporidium parvum in human fecal specimens.
J. Clin. Microbiol.
35:1526-1529[Abstract].
|
| 6.
|
Graczyk, T. K.,
M. R. Cranfield, and R. Fayer.
1996.
Evaluation of commercial enzyme immunoassay (EIA) and immunofluorescent antibody (FA) test kits for detection of Cryptosporidium oocysts of species other than Cryptosporidium parvum.
Am. J. Trop. Med. Hyg.
54:274-279.
|
| 7.
|
Hanahan, D.
1983.
Studies on the transformation of Escherichia coli with plasmids.
J. Mol. Biol.
166:557-580[Medline].
|
| 8.
|
Harp, J. A.,
D. B. Woodmansee, and H. W. Moon.
1989.
Effects of colostral antibody on susceptibility of calves to Cryptosporidium parvum infection.
Am. J. Vet. Res.
50:2117-2119[Medline].
|
| 9.
|
Harp, J. A.,
D. B. Woodmansee, and H. W. Moon.
1990.
Resistance of calves to Cryptosporidium parvum: effects of age and previous exposure.
Infect. Immun.
58:2237-2240[Abstract/Free Full Text].
|
| 10.
|
Ignatius, R.,
M. Eisenblatter,
T. Regnath,
U. Mansmann,
U. Futh,
H. Hahn, and J. Wagner.
1997.
Efficacy of different methods for detection of low Cryptosporidium parvum oocyst numbers or antigen concentrations in stool specimens.
Euro. J. Clin. Microbiol. Infect. Dis.
16:732-736[Medline].
|
| 11.
|
Jenkins, M. C.,
R. Fayer,
M. Tilley, and S. J. Upton.
1993.
Cloning and expression of cDNA encoding epitopes shared by 15- and 60-kilodalton proteins of Cryptosporidium parvum sporozoites.
Infect. Immun.
61:2377-2382[Abstract/Free Full Text].
|
| 12.
|
Jenkins, M. C.,
W. Wouda, and J. P. Dubey.
1997.
Serological response over time to recombinant Neospora caninum antigens in cattle after a neosporosis-induced abortion.
Clin. Diagn. Lab. Immunol.
4:270-274[Abstract].
|
| 13.
|
Jenkins, M. C.,
J. Trout, and R. Fayer.
1998.
Development and application of an improved semi-quantitative technique for detecting low level Cryptosporidium parvum infections in mouse tissue using polymerase chain reaction.
J. Parasitol.
84:182-186[Medline].
|
| 14.
|
Kehl, K. S.,
H. Cicirello, and P. L. Havens.
1995.
Comparison of four different methods for detection of Cryptosporidium species.
J. Clin. Microbiol.
33:416-418[Abstract].
|
| 15.
|
Kilani, R. T., and L. Sekla.
1987.
Purification of Cryptosporidium oocysts and sporozoites by cesium chloride and Percoll gradients.
Am. J. Trop. Med. Hyg.
36:505-508.
|
| 16.
|
Kim, K. S.,
M. C. Jenkins, and H. S. Lillehoj.
1989.
Immunization of chickens with live Escherichia coli expressing Eimeria acervulina merozoite recombinant antigen induces partial protection against coccidiosis.
Infect. Immun.
57:2434-2440[Abstract/Free Full Text].
|
| 17.
|
Ko, C.,
C. K. Smith, and M. McDonell.
1990.
Identification and characterization of a target antigen of a monoclonal antibody directed against Eimeria tenella merozoites.
Mol. Biochem. Parasitol.
41:53-64[Medline].
|
| 18.
|
Kozak, M.
1989.
The scanning model for translation: an update.
J. Cell Biol.
108:229-239[Abstract/Free Full Text].
|
| 19.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680-685[Medline].
|
| 20.
|
Lorenzo, M. J.,
B. Ben,
F. Mendez,
I. Villacorta, and M. E. Ares-Mazas.
1995.
Cryptosporidium parvum oocyst antigens recognized by sera from infected asymptomatic adult cattle.
Vet. Parasitol.
60:17-25[Medline].
|
| 21.
|
Lumb, R.,
J. A. Lanser, and P. J. O'Donoghue.
1988.
Electrophoretic and immunoblot analysis of Cryptosporidium oocysts.
Immunol. Cell Biol.
66:369-376.
|
| 22.
|
Lumb, R.,
P. S. Smith,
R. Davies,
P. J. O'Donoghue,
H. M. Atkinson, and J. A. Lanser.
1989.
Localization of a 23,000 MW antigen of Cryptosporidium by immunoelectron microscopy.
Immunol. Cell Biol.
67:267-270.
|
| 23.
|
McDonald, V.,
R. M. A. Deer,
S. E. Wright,
D. A. Dyson,
P. L. Chiodini, and K. P. McAdam.
1992.
Comparative study of the antigenic composition of oocyst isolates of Cryptosporidium parvum from different hosts.
Parasite Immunol.
14:227-232[Medline].
|
| 24.
|
McLauchlin, J.,
D. P. Casemore,
S. Moran, and S. Patel.
1998.
The epidemiology of cryptosporidiosis: application of experimental sub-typing and antibody detection systems to the investigation of water-borne outbreaks.
Folia Parasitol.
45:83-92.
|
| 25.
|
Mead, J. R.,
M. J. Arrowood, and C. R. Sterling.
1988.
Antigens of Cryptosporidium sporozoites recognized by immune sera of infected animals and humans.
J. Parasitol.
74:135-143[Medline].
|
| 26.
|
Moss, D. M.,
C. L. Chappell,
P. C. Okhuysen,
H. L. DuPont,
M. J. Arrowood,
A. W. Hightower, and P. J. Lammie.
1998.
The antibody response to 27-, 17-, and 15-kDa Cryptosporidium antigens following experimental infections in humans.
J. Infect. Dis.
178:827-833[Medline].
|
| 27.
|
Nina, J. M. S.,
V. McDonald,
D. A. Dyson,
J. Catchpole,
S. Uni,
M. Iseki,
P. L. Chiodini, and K. P. W. J. McAdam.
1992.
Analysis of oocyst wall and sporozoite antigens from three Cryptosporidium species.
Infect. Immun.
60:1509-1513[Abstract/Free Full Text].
|
| 28.
|
Ortega-Mora, L. M.,
J. M. Troncoso,
F. A. Rojo-Vazquez, and M. Gomez-Bautista.
1994.
Identification of Cryptosporidium parvum oocyst/sporozoite antigens recognized by infected and hyperimmune lambs.
Vet. Parasitol.
53:159-166[Medline].
|
| 29.
|
Peeters, J. E.,
I. Villacorta,
E. Vanopdenbosch,
D. Vandergheynst,
M. Naciri,
E. Ares-Mazás, and P. Yvoré.
1992.
Cryptosporidium parvum in calves: kinetics and immunoblot analysis of specific serum and local antibody responses (immunoglobulin A [IgA], IgG, and IgM) after natural and experimental infections.
Infect. Immun.
60:2309-2316[Abstract/Free Full Text].
|
| 30.
|
Perryman, L. E.,
D. P. Jasmer,
M. W. Riggs,
S. G. Bohnet,
T. C. McGuire, and M. J. Arrowood.
1996.
A cloned gene of Cryptosporidium parvum encodes neutralization-sensitive epitopes.
Mol. Biochem. Parasitol.
80:137-147[Medline].
|
| 31.
|
Quilez, J.,
C. Sanchez-Acedo,
A. Clavel,
E. del Cacho, and F. Lopez-Bernard.
1996.
Comparison of acid-fast stain and a monoclonal antibody-based immunofluorescence reagent for the detection of Cryptosporidium oocysts in fecal specimens from cattle and pigs.
Vet. Parasitol.
67:75-81[Medline].
|
| 32.
|
Reperant, J. M.,
M. Naciri,
S. Iochmann,
M. Tilley, and D. T. Bout.
1994.
Major antigens of Cryptosporidium parvum recognised by serum antibodies from different infected animal species and man.
Vet. Parasitol.
55:1-13[Medline].
|
| 33.
|
Tilley, M.,
R. Fayer,
A. Guidry,
S. J. Upton, and B. L. Blagburn.
1990.
Cryptosporidium parvum (Apicomplexa:Cryptospordiidae) oocyst and sporozoite antigens recognized by bovine colostral antibodies.
Infect Immun.
58:2966-2971[Abstract/Free Full Text].
|
| 34.
|
Tomley, F. M.,
J. M. Bumstead,
K. J. Billington, and P. J. Dunn.
1996.
Molecular cloning and characterization of a novel acidic microneme protein (Etmic-2) from apicomplexan protozoan parasite, Eimeria tenella.
Mol. Biochem. Parasitol.
79:195-206[Medline].
|
| 35.
|
Vetterling, J. M.
1969.
Continuous-flow differential density flotation of coccidial oocysts and a comparison with other methods.
J. Parasitol.
55:412-417[Medline].
|
| 36.
|
Whitmire, W. M., and J. A. Harp.
1991.
Characterization of bovine cellular and serum antibody responses during infection by Cryptosporidium parvum.
Infect. Immun.
59:990-995[Abstract/Free Full Text].
|