CVI
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vizzi, E.
Right arrow Articles by Ludert, J. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vizzi, E.
Right arrow Articles by Ludert, J. E.
Clinical and Diagnostic Laboratory Immunology, October 2005, p. 1157-1163, Vol. 12, No. 10
1071-412X/05/$08.00+0     doi:10.1128/CDLI.12.10.1157-1163.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Evaluation of Serum Antibody Responses against the Rotavirus Nonstructural Protein NSP4 in Children after Rhesus Rotavirus Tetravalent Vaccination or Natural Infection

Esmeralda Vizzi,1* Eva Calviño,1 Rosabel González,2 Irene Pérez-Schael,2 Max Ciarlet,3,{dagger} Gagandeep Kang,3,{ddagger} Mary K. Estes,3 Ferdinando Liprandi,1 and Juan E. Ludert1

Laboratorio de Biología de Virus, Centro de Microbiología y Biología Celular, IVIC, Caracas, Venezuela,1 Instituto de Biomedicina, MSDS, UCV, Caracas, Venezuela,2 Department of Molecular Virology and Microbiology, Baylor College of Medicine, Houston, Texas3

Received 9 May 2005/ Returned for modification 11 July 2005/ Accepted 14 August 2005


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The immune response elicited by the rotavirus nonstructural protein NSP4 and its potential role in protection against rotavirus disease are not well understood. We investigated the serological response to NSP4 and its correlation with disease protection in sera from 110 children suffering acute diarrhea, associated or not with rotavirus, and from 26 children who were recipients of the rhesus rotavirus tetravalent (RRV-TV) vaccine. We used, as antigens in an enzyme-linked immunosorbent assay (ELISA), affinity-purified recombinant NSP4 (residues 85 to 175) from strains SA11, Wa, and RRV (genotypes A, B, and C, respectively) fused to glutathione S-transferase. Seroconversion to NSP4 was observed in 54% (42/78) of the children who suffered from natural rotavirus infection and in 8% (2/26) of the RRV-TV vaccine recipients. Our findings indicate that NSP4 evokes significantly (P < 0.05) higher seroconversion rates after natural infection than after RRV-TV vaccination. The serum antibody levels to NSP4 were modest (titers of ≤200) in most of the infected and vaccinated children. A heterotypic NSP4 response was detected in 48% of the naturally rotavirus-infected children with a detectable response to NSP4. Following natural infection or RRV-TV vaccination, NSP4 was significantly less immunogenic than the VP6 protein when these responses were independently measured by ELISA. A significant (P < 0.05) proportion of children who did not develop diarrhea associated with rotavirus had antibodies to NSP4 in acute-phase serum, suggesting that serum antibodies against NSP4 might correlate with protection from rotavirus diarrhea. In addition, previous exposures to rotavirus did not affect the NSP4 seroconversion rate.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Rotaviruses are the most important cause of severe diarrhea in infants and young children worldwide. Great efforts are being made to develop an effective vaccine that could reduce significantly the severity of the episodes of diarrhea in children. However, the immune mechanisms induced by natural rotavirus infection or immunization that lead to protection remain partially understood. Previous studies in animal models and humans, which investigated the effects of antirotavirus serum antibodies in protection from rotavirus disease or infection, have often yielded conflicting results about the correlates of protection against rotavirus disease (10, 13, 16, 23, 30).

Whether neutralizing antibody responses to outer capsid proteins VP4 and VP7 play a critical role in protective immunity against rotavirus-associated diarrhea remains controversial. Early studies focused on serum antibody responses to different G (VP7) serotypes, as measured by neutralization assays, and suggested that serotype cross-reactive immunity plays an important role in protection, but this has been difficult to demonstrate in humans (7, 13, 16, 29). Nonneutralizing antibodies against the inner capsid protein VP6 have also been shown to protect mice against disease after DNA vaccination or virus-like particle administration (3, 6, 22). The role of nonstructural proteins in the induction of protective immunity has not been extensively studied in rotavirus infections, but it has recently emerged from studies of infections by flavivirus and hepatitis C virus (9, 12).

NSP4, a rotavirus nonstructural glycoprotein, plays a role in rotavirus morphogenesis (1) and is the viral enterotoxin capable of inducing secretory diarrhea in infant mice (2). Sequence analyses of the rotavirus enterotoxin NSP4 from humans and animals have revealed the existence of six (A to F) distinct NSP4 genotypes. Although both human and animal rotavirus strains can be grouped in the same NSP4 genotype, known human NSP4 sequences belong to NSP4 genotypes A, B, and C (8, 20). Passively acquired antibodies to NSP4 have been demonstrated to reduce both the incidence and severity of diarrhea in infant mouse pups challenged with virulent rotavirus (2), suggesting that the immune response to NSP4 could modulate rotavirus diarrhea in humans. However, the exact role of NSP4 in protection from rotavirus disease in humans has not been fully investigated. Studies with a limited number of subjects have revealed variable levels of immunogenicity of NSP4 after natural infection or vaccination, probably due to the use of the different assays or antigens employed (17, 25, 26, 33). Moreover, the response to NSP4 appears to be heterotypic, meaning that antibodies to NSP4 recognize one or more of the known human NSP4 genotypes (25, 33). It is unknown if the immune response against NSP4 plays a role in protection from diarrhea. The aim of the present study was to determine the total serum antibody responses to NSP4 in children following rhesus rotavirus tetravalent (RRV-TV) vaccination or natural rotavirus infection, and to evaluate whether the NSP4 immune response correlates with protection against rotavirus diarrhea.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Subjects and serum samples. The study population comprised the following: (i) 2-, 3-, and 4-month-old children who received three doses at high titer (106 PFU of each component) (n = 11) or three doses at low titer (105 PFU) (n = 15) of RRV-TV and children who received placebo (n = 15) enrolled during an earlier phase II study conducted in 1991 in Caracas, Venezuela (11); (ii) 78 children, not previously vaccinated (average age, 10.1 months; range, 1 to 59 months), with acute watery diarrhea due to natural rotavirus infection; and (iii) 32 children (average age, 15.2 months; range, 1 to 60 months) suffering from rotavirus-negative diarrhea episodes. The diarrheic children were patients who attended the Ciudad Hospitalaria "Dr. Enrique Tejera" (CHTE) in Carabobo State, Venezuela (27).

Serum samples of RRV-TV- or placebo-vaccinated children with no acute diarrhea episode were collected before the first dose and 1 month after the first and third doses, and those from infants with diarrhea were obtained during the episodes within the first week after the onset of diarrhea. A convalescent-phase serum was collected 3 to 4 weeks after the episode. Acute diarrhea was defined as the occurrence of three or more bowel movements within a 24-h period, with a decrease in stool consistency. Stool samples from diarrheic infants were obtained within 72 h after the onset of symptoms and were previously examined for the presence of rotavirus antigen by enzyme-linked immunosorbent assay (ELISA) (18). Both stool and serum samples were kept frozen (–20°C) until tested.

Construction of plasmids for recombinant NSP4 (rNSP4) protein production in E. coli. Reverse transcriptase was used to generate gene 10 cDNAs, encoding the NSP4 of simian SA11 (genotype A), human Wa (genotype B), and simian RRV (genotype C) strains as described elsewhere (8). Full-length amplified DNA fragments of 751 bp were generated by PCR and subsequently cloned into pCRII-TOPO vector (Invitrogen Corp., San Diego, CA). The nucleotide regions encoding amino acids 85 to 175 of each NSP4 genotype were reamplified using respective complementary primers flanking the ends (GIBCO BRL Life Technologies, Grand Island, NY). Primers included EcoRI and BamHI restriction sites to clone in the procaryotic expression vector pGEX-2TK (Amersham Pharmacia Biotech, UK Ltd., Buckinghamshire, England). The 5'->3' nucleotide sequences (positions) of the primers used were as follows: CGCGGATCCATGTATAAAGAGCAGATAACTACT (nucleotides [nt] 294 to 314) and GGAATTCCGGTCACATTAAGACCGTTCCTT (nt 730 to 751) for the SA11 strain, CGCGGATCCATGTATAAAGAGCAGGTTACTACA (nt 294 to 314) and CCGCAATTGGGTCACACTAAGACCATTCCTT (nt 729 to 751) for the Wa strain, and GGAAGATCTATGTATAAAGAACAAATTACTACT (nt 294 to 314) and CCGCAATTGGGTCACACTAAGACCATTCCT (nt 730 to 751) for the RRV strain. A PCR product of 478 or 479 bp, depending on the primer set, was generated for each rotavirus strain after 25 cycles of PCR amplification. Three recombinant plasmids were obtained in Escherichia coli BL21(DE3) cells (Novagen Inc., Madison, WI), one for each NSP4 allele. Confirmation of the DNA sequence was performed by automated DNA sequencing with dye terminator labeling of both DNA strands of each of the different clones.

Expression and purification of rNSP4 proteins in E. coli. Recombinant clones expressing each of the rNSP4(85-175) peptides as fusion proteins with the glutathione S-transferase (GST) protein, or wild-type GST alone in parallel, were obtained from bacterial cultures grown in LB broth supplemented with 100 µg/ml of ampicillin at 37°C. Protein expression was induced with 0.75 mM isopropyl-ß-D-thiogalactopyranoside (IPTG). After a 3-h incubation in a shaker at 37°C, the cells were harvested and pelleted by centrifugation at 8,000 rpm for 20 min. The pellets were lysed using B-PER reagent (Pierce, Rockford, IL), and the soluble proteins were separated from the insoluble fractions by centrifugation at 14,000 rpm at 4°C. Triton X-100 was added to the supernatant to reach a final concentration of 1%. The rNSP4 proteins were purified by affinity chromatography with glutathione Sepharose 4B beads (Amersham Pharmacia Biotech, UK Ltd., Buckinghamshire, England) as recommended by the manufacturer and eluted with glutathione buffer (20 mM reduced glutathione [Sigma Chemical Co., St. Louis, MO] in 50 mM Tris-HCl, pH 8.5). At the final step, the glutathione was removed by being dialyzed against three changes of phosphate-buffered saline (PBS), pH 7.2. The protein concentration of the preparations was determined by protein-dye binding (Bio-Rad Laboratories, Hercules, CA). The proteins were stored at –20°C in the presence of protease inhibitors aprotinin and leupeptin (Amersham Pharmacia Biotech, UK Ltd., Buckinghamshire, England), at a concentration of 0.5 µg/ml, to prevent proteolytic degradation.

SDS-PAGE and Western blot analysis. Preparations of 10 µg each of purified GST and rNSP4(85-175) proteins from rotavirus simian SA11 (genotype A), human Wa (genotype B), and simian RRV (genotype C) strains were further characterized by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and visualized by Coomassie blue staining. For Western blotting analysis, the fractionated products were transferred onto nitrocellulose (Amersham Pharmacia Biotech, UK Ltd., Buckinghamshire, England) and probed using GST-specific antibodies produced in a goat (Amersham Pharmacia Biotech, UK Ltd., Buckinghamshire, England) and a monoclonal antibody (MAb), B4-2/55 (24), specific to NSP4 (kindly supplied by H. B. Greenberg, Stanford University Medical School, Palo Alto, CA). A colorimetric standard method using alkaline phosphatase-conjugated antibodies, 5-bromo-4-chloro-3-indolyl phosphate, and p-nitroblue tetrazolium chloride was used to develop the blotting reactions.

ELISA to detect antibodies against rNSP4. For NSP4 antibody assays, 96-well flat-bottomed microtiter plates (Immulon 2; Dynatech Laboratories, Inc. Chantilly, VA) were coated with reduced glutathione as previously described (21) with some modifications. Briefly, the plates were incubated overnight with 2% bovine hemoglobin (Sigma Chemical Co., St. Louis, MO) in 0.05 M sodium carbonate, pH 9.6, at 4°C. After 6 washes with PBS, the heterobifunctional cross-linker sulfosuccinimidyl 4-(p-maleimidophenyl)-butyrate (SSMPB) (Pierce, Rockford, IL) was coupled to the bound hemoglobin by adding a freshly prepared solution (0.1 mM of cross-linker in PBS) and incubating this mixture for 1 h at room temperature. After six washes with PBS, a freshly prepared solution of 10 mM reduced glutathione in degassed 10 mM sodium phosphate, 0.15 mM sodium chloride, 1 mM EDTA, pH 6.7, was added and the mixture was incubated overnight at 4°C. The glutathione-coated plates were then washed 6 times with PBS containing 0.05% Tween 20 (PBS-T) and were used directly. Affinity-purified rNSP4(85-175) proteins (3 µg/ml for well) from simian rotavirus SA11 (genotype A), human Wa (genotype B), or simian RRV (genotype C) strains in PBS were added to alternate rows of glutathione-coated plates (100 µl/well) and incubated at room temperature for 2 h. GST protein alone was added to the first row and used to blank each serum test. The plates were washed six times with PBS-T and blocked with 200 µl/well of 10% nonfat dry milk in PBS for 1 h. After six washes with PBS-T, paired sera from each patient diluted in the blocking solution were tested in the same plate (serial twofold dilutions starting at 1:50) against each of the coated GST and rNSP4(85-175) proteins. Two positive internal controls, a goat anti-GST serum (Amersham Pharmacia Biotech, UK Ltd., Buckinghamshire, England) and the anti-NSP4 MAb B4-2/55, were included on each plate, serially diluted, to validate the assay and to ensure the reproducibility of the results. After incubation at room temperature for 1 h, the plates were washed six times with PBS-T and the appropriate secondary antibody conjugated to horseradish peroxidase (rabbit anti-human polyvalent immunoglobulins [Igs] diluted 1:8,000; or rabbit anti-goat IgG [Sigma Chemical Co., St. Louis, MO] or goat anti-mouse IgA, -G, and -M [Kirkegaard & Perry Laboratories, Inc., Gaithersburg, MD] diluted 1:4,000) was added. After incubation for 1 h at room temperature, the plates were washed six times with PBS-T and the reaction was developed with 3',3',5',5'tetramethylbenzidine substrate system (Kirkegaard & Perry Laboratories, Inc., Gaithersburg, MD), stopping the reaction after 10 min with 1.0 M phosphoric acid. The absorbance was measured within 15 min at 450 nm on an ELISA plate reader (Sunrise, TECAN, Austria GmbH). The net optical density (OD) value of each test for the NSP4 antigen was obtained by subtracting the OD of serum reacting with GST protein from the OD of serum reacting with each rNSP4(85-175) protein, to allow determination of the proportion of signal due to antibodies to NSP4 alone. The antibody titer for each antigen was defined as the reciprocal of the highest dilution giving a net OD value greater than the calculated cutoff, 0.1. Seroconversion was defined as a ≥3-fold rise in antibody titer between consecutive serum samples from the same individual. This seroconversion criterion was defined after repeated testing of a subset of positive and negative human serum samples, to compensate for the moderate background values found when serum samples from humans were tested.

ELISA to detect anti-VP6 antibodies. Antibodies to rotavirus capsid protein VP6 were determined by ELISA using a purified MAb against VP6, 4B2D2 (19), to coat the plates. Tissue culture-passaged rotavirus OSU and mock-infected MA104 cell lysates, pretreated with 1.0 mM EDTA, were used as antigens in alternate columns to test serially diluted human sera starting at 1:25. A positive control human serum was included in each plate to verify the performance of the assay and to ensure the reproducibility of the results. A sample was considered positive at a given dilution if the OD value of the well coated with OSU was ≥2-fold the value corresponding to the well with mock-infected cells. The endpoint antibody titer of each sample was expressed as the reciprocal of the highest dilution that had a corrected A450 value (OD value in OSU-coated well – OD value in mock-infected cell antigen-coated well) greater than the calculated cutoff value of 0.16. This value was chosen because it was greater than 2 standard deviations above the mean of the background values obtained testing 10 negative serum samples. Seroconversion was defined as a ≥4-fold rise in antibody titer between consecutive serum samples from the same individual.

Statistical analysis. Data were analyzed by EpiInfo software (version 3.2.2; CDC, Atlanta, GA) for the comparisons of the seroconversion rates between selected groups by 2 by 2 tables with {chi}2 test or Fisher's exact test (two-tailed) when the size sample was less than 5. McNemar's test was used to evaluate correlated proportions on the same group of subjects. Pearson's correlation coefficients (r values) were calculated to analyze the correlation between antibody titers to NSP4 or VP6 and protection from diarrhea. Student's test was applied to logarithmically transformed (base 10) titers (convalescent-phase serum titer – acute-phase serum titer) for comparisons of antibody response in children with rotavirus-associated diarrhea. Statistical significance was assessed at P < 0.05 for all the analyses in this study.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cloning, expression, and production of the rNSP4(85-175) proteins. Recombinant GST-NSP4(85-175) fusion proteins from the rotavirus SA11, Wa, and RRV strains, representing NSP4 genotypes A, B, and C, respectively, and GST protein alone were expressed in E. coli BL21(DE3) cells. Approximately 25 mg of the recombinant proteins was produced per liter of bacterial culture with each of the clones. When visualized by PAGE, the molecular masses of the rNSP4(85-175) and GST proteins were approximately 34 kDa and 26 kDa, respectively (Fig. 1A). The Western blotting analysis with anti-GST goat serum antibodies and anti-NSP4 MAb B4-2/55 confirmed the identity of the preparations. Anti-GST serum antibodies bound to all rNSP4(85-175) and to GST proteins, while the anti-NSP4 MAb B4-2/55 reacted specifically with 34-kDa rNSP4(85-175) proteins and not with 26-kDa GST (Fig. 1B).



View larger version (53K):
[in this window]
[in a new window]
 
FIG. 1. Analysis of the recombinant NSP4(85-175)-GST fusion proteins obtained after cloning. (A) Electrophoresis (12% SDS-PAGE) of the protein products from E. coli extracts stained with Coomassie blue. MW, prestained protein molecular mass ladder (GIBCO BRL). Shown are the results with culture lysates (L) and purified recombinant proteins (P) to GST protein (lanes 1 and 8), SA11-GST fusion protein (lanes 2 and 5), Wa-GST fusion protein (lanes 3 and 6), and RRV-GST fusion protein (lanes 4 and 7). (B) Western blot of the purified recombinant products using anti-GST goat serum (i) or anti-NSP4 B4-2/55 monoclonal antibody (ii) as detection antibodies. Lane 1, SA11-GST; lane 2, Wa-GST; lane 3, RRV-GST fusion proteins; lane 4 GST protein; MW, prestained protein molecular mass ladder (GIBCO BRL).

 
Serum antibody response to rNSP4 in unvaccinated children with diarrhea. As shown in Table 1, the seroconversion rate to rNSP4 was significantly higher (P < 0.05) in children with rotavirus-associated diarrhea than in children with non-rotavirus-associated diarrhea (54 versus 6%). Reactivity to more than one NSP4 genotype was detected in 20 of the 42 (48%) children infected with rotavirus who responded to rNSP4, and the most common NSP4 antibody response was directed against the genotype B (Wa) antigen (100%). The NSP4 antibody titers were ≤200 in most of the children who responded against one or more antigens of NSP4 (ranging from 50% to 62%, depending on the NSP4 antigen examined) (Fig. 2). No significant difference (P > 0.05) was observed in seroconversion rates to rNSP4 among rotavirus-infected children of different ages (data not shown).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Seroconversion rates to rNSP4(85-175) and VP6 in different groups of children

 


View larger version (34K):
[in this window]
[in a new window]
 
FIG. 2. Serum antibody titers against NSP4 of different genotypes from 78 children convalescing from rotavirus-associated diarrhea.

 
Serum antibody response to rNSP4 in RRV-TV-vaccinated children. To measure the antibody response attributed solely to vaccination, 26 children who received the RRV-TV vaccine and did not develop diarrhea during the follow-up period (8 months total) were studied. Of the 26 children, only 2 who had received three doses of vaccine at low and at high titer, respectively, developed antibodies to rNSP4 after vaccination (Table 1), and antibody responses of both children were directed toward more than one type of NSP4 antigen whose titers were ≤100. Thus, the seroconversion rate to rNSP4 after vaccination was significantly lower (P < 0.05) than that after natural infection (8 versus 54%). Furthermore, it was noticed that two other vaccinated children responded with very low antibody titers (titer of 50) against rNSP4 of genotype A (SA11), but they did not reach the ≥3-fold-rise seroconversion criterion defined above (data not shown) and were not counted. Placebo recipients showed seroconversion rates to rNSP4 comparable to those of the children with non-rotavirus-associated diarrhea (Table 1).

Serum antibody response to rotavirus VP6. The serum antibody response to the VP6 protein was studied, and the results are shown in Table 1. The seroconversion rate to VP6 was significantly higher (P < 0.05) in children with rotavirus-associated diarrhea than in those suffering an episode of diarrhea not associated with rotavirus (72 versus 13%). Additionally, the seroconversion rate to VP6 was also significantly higher (P < 0.05) in diarrheic rotavirus-infected children than in RRV-TV recipients (31%). Placebo recipients showed a seroconversion rate to VP6 comparable to that of the children suffering an episode of non-rotavirus-associated diarrhea (Table 1).

The mean antibody titers to VP6 in children who developed a rotavirus-associated-diarrhea were significantly higher (P < 0.05) than those detected against rNSP4 (geometric mean titer [GMT] = 650 to VP6 versus GMT = 235, 240, or 290, respectively, to NSP4 A, B, or C antigen). The seroconversion rate observed to VP6 was higher than that detected to rNSP4 not only after natural infection but also after RRV-TV vaccination (Table 1).

Presence of baseline antibodies against rNSP4 or VP6 as a correlate of protection. The role of serum antibodies as a marker of protection against rotavirus diarrhea was evaluated in children suffering from diarrhea, according to the occurrence of an episode associated or not with rotavirus. Table 2 shows the prevalence of total serum antibodies against rNSP4 or against VP6 in the serum samples collected in the acute phase (baseline antibodies) from 78 children who developed rotavirus-associated diarrhea and 32 who suffered from diarrhea not associated with rotavirus. A detectable baseline level of antibodies was defined by the presence of an ELISA signal (net OD) to VP6 or to rNSP4 greater than the calculated cutoff at the lower dilution of serum tested (as explained in Materials and Methods). As shown in Table 2, a positive correlation between the presence of baseline antibodies against rNSP4 and protection from rotavirus diarrhea was observed, as a significant proportion (19%) of children who did not develop diarrhea associated with rotavirus had baseline antibodies to rNSP4, in comparison with those who developed rotavirus-associated diarrhea (r < 0.3, P < 0.05; Pearson's correlation coefficient). Similarly, a significant correlation between the presence of baseline antibodies to VP6 and protection from rotavirus diarrhea was detected, since most of the children (53%) who did not develop diarrhea associated with rotavirus had VP6 baseline antibodies, in comparison with the lower percentage (18%) of those who developed rotavirus-associated diarrhea (r < 0.3, P < 0.05, Pearson's correlation coefficient).


View this table:
[in this window]
[in a new window]
 
TABLE 2. Preexisting antibodies to NSP4 or VP6 proteins in children with acute diarrhea associated or not with rotavirus

 
Effect of prior exposure to rotavirus infection on the immune responses to rNSP4 and VP6. To evaluate the effect that prior exposure to rotavirus infection had on the immune response to NSP4 and VP6, the presence of baseline antibodies against both proteins was compared with the seroconversion rates to rNSP4 and VP6 detected in 78 children who developed rotavirus-associated diarrhea. Detectable antibodies to either antigen constituted evidence of prior exposure to rotavirus, but because no children had detectable levels of baseline antibodies against rNSP4, all of the results were based on the detection results of baseline antibodies to VP6. As shown in Table 3, the seroconversion rates to rNSP4 were similar (P > 0.05) in children with or without detectable baseline antibodies (50 versus 55%), while the seroconversion rate to VP6 was significantly lower (P < 0.05) among those with detectable baseline antibodies than it was among children without detectable baseline antibodies (43 versus 78%). Such an immunomodulatory effect was not observed in the group of RRV-TV-vaccinated children. Rotavirus antibodies detected in sera collected before the first dose of vaccine, presumably passively acquired antibodies of maternal origin, had no effect on the seroconversion rates obtained to either VP6 or rNSP4 (data not shown).


View this table:
[in this window]
[in a new window]
 
TABLE 3. Seroconversion rates to NSP4 or VP6 proteins, in children suffering from rotavirus-associated diarrhea, according to the presence or absence of baseline antibody to rotavirus

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Since NSP4 was reported to function as a viral enterotoxin (2), efforts are being made to understand its role in rotavirus pathogenesis and immunity. Little information is available about the contribution of NSP4 or any other rotavirus nonstructural protein to the induction of a protective immune response after natural infection or vaccination (14, 15, 26, 32, 33). Several techniques have been applied to quantify the level of NSP4 antibody response in children (15, 17, 25, 26, 33). However, the results have been variable, probably due to differences in sample size, antigens used, and the nature and sensitivity of the applied assays. Because divergence in NSP4 amino acid sequence might also have affected the detection rate of the NSP4 antibody responses in those previous studies (15, 17, 26), we decided to include in our assay rNSP4 antigens representative of the three known human rotavirus NSP4 genotypes (A, B, and C). The use of GST fusion proteins captured by immobilizing glutathione on ELISA microtiter plates probably allows antigen preservation in a more native conformation than does a simple direct adsorption to the plastic surface (21). In addition, it enables the testing of large numbers of specimens and quantification in parallel of the immune responses against all three types of NSP4 antigens.

So far, an evaluation of the NSP4 seroconversion rates in children after rotavirus natural infection and vaccination using the same assay to detect antibodies has not been carried out. In this report, we compared the NSP4 and VP6 antibody responses in children with rotavirus-associated diarrhea and in children following RRV-TV immunization. The seroconversion rates to NSP4 observed after natural infection and after vaccination were both comparable to those described in previous studies (25, 33). Rotavirus natural infection was observed to elicit a seroresponse against NSP4 in 54% of the children, a rate similar to that reported by Ray et al. (25) in a study by ELISA including 40 rotavirus-infected children conducted in New Delhi, India. In our study, the seroconversion rate to NSP4 after RRV-TV vaccination was significantly lower (P < 0.05) than those observed after natural infection. Low seroconvertion rates to NSP4 after vaccination were also found by Yuan et al. (33) in a study based on the use of an immunocytochemical staining assay which included 12 RRV-TV-vaccinated Finnish children.

In the present report, the seroconversion rates to NSP4 were significantly lower than those detected to VP6 in diarrheic children infected with rotavirus and in RRV-TV vaccine recipients. This result contrasts with that obtained by Ray et al. (25), who described a seroconversion rate to NSP4 as high as the one obtained for the whole virus in children with rotavirus-associated diarrhea. Differences in the design of the assays used may in part account for this variation. On the other hand, Yuan et al. (33) found percentages of seroresponse to NSP4 lower than those to VP6 after RRV-TV vaccination, in agreement with our data. Taken together, our data indicate that RRV-TV vaccine can induce serum antibodies to NSP4 and VP6. However, the vaccination appears to be less efficient than natural infection in inducing antibodies to both proteins. The differences found in seroconversion rates to both proteins NSP4 and VP6 in naturally rotavirus-infected and RRV-TV-vaccinated children are difficult to explain. Most likely they reflect differences in the way both antigens are processed and are presented to the immune system following homologous and heterologous rotavirus infection. In addition, differences in seroconversion rate due also to the younger age of the vaccinated infants cannot be ruled out.

In this study, all the children who seroconverted to NSP4 after natural infection showed a response to NSP4 genotype B antigen, but it was also evident that many of the children recognized at least one additional NSP4 genotype, supporting the notion that antibody response to NSP4 is at least partially heterotypic (25, 33). Both natural infection and RRV-TV vaccination generated modest or low serum antibody titers to NSP4: e.g., ≤200. Johansen et al. (17) also found modest serum IgG antibody responses against NSP4(SA11) in children following natural infection and RRV-TV vaccination (GMT of 324 and 259, respectively), responses that were significantly lower (P < 0.05) than those against VP6. Very low serum titers to NSP4 were also found after homologous (EHP) or heterologous (RRV) rotavirus infection in mice by other authors (15). In addition, we found that prior natural exposure to rotavirus, revealed by the presence of baseline antibodies, did not result in higher antibody titers in subjects who experienced subsequent natural rotavirus diarrhea (data not shown), suggesting a lack of a priming effect. The modest titers to the NSP4 protein were obtained independently of the peptide used in the ELISA. High levels of NSP4 protein are produced after rotavirus replication in cultured cells and presumably also in vivo (4, 28). Therefore, such modest levels of NSP4 antibody response may not be directly related to the amount of antigen produced. Instead, they may be a consequence of ineffective NSP4 epitope exposure or presentation to the immunologic system. It is unclear how long lasting the antibody response is to NSP4, but the low NSP4 antibody titers generated after acute infection suggest that they will fall below detection levels sooner than do antibodies to other proteins, such as VP6, and therefore may only be detected briefly after rotavirus infection.

The role of the antibody response against NSP4 in protection against rotavirus diarrhea is not clear. We found a positive correlation between the presence of baseline serum antibodies against NSP4 and protection from rotavirus diarrhea. This observation suggests that NSP4 antibodies may play a role in disease protection after natural infection, but we cannot exclude the possibility that such antibodies merely reflect a recent infection and are only a general indicator for the true effectors of protection from disease. A limitation of this study is that total levels of antibody binding the recombinant NSP4 antigen in the ELISA may not be an exact reflection of the antibodies involved in protection, i.e., those antibodies putatively able to neutralize the toxigenic activity of NSP4. In the same way, we observed that the presence of VP6 antibodies correlated positively with protection. Correlation between serum VP6 antibodies and protection has been observed previously (5). On the other hand, the lack of correlation between seroconversion rate to NSP4 and protection afforded by the RRV-TV vaccine suggests other mechanisms may be involved in the induction of a protective response. Other host effectors, such as rotavirus-specific B, CD4+, and CD8+ T cells, can mediate antiviral activity in humans, and the relative importance of each appears to be dependent on the immunogen and route of administration, as has been demonstrated in the adult mouse model (31). Further studies are needed to assess if NSP4 antibodies are directly involved in disease protection after natural infection or RRV-TV vaccination.

In contrast to the results obtained by Ray et al. (25), our results suggest that prior exposures to rotavirus limit the response to VP6, but not to NSP4, during natural rotavirus infection. Preexisting antibodies might affect the induction of an immune response by suppressing or enhancing the secondary antibody response, depending on the level and specificity of such antibodies, as suggested by other authors (33). Moreover, such responses might depend on the nature or immunogenic features of the antigen. NSP4 and VP6 may induce different humoral (immunologic memory) or cellular (immunosuppressor cells) immune mechanisms during a first infection, which would result in dissimilar secondary immune responses.

To conclude, our findings indicate that rotavirus nonstructural protein NSP4 evokes moderate seroconversion rates after natural infection but lower rates after RRV-TV vaccination. Also in both cases, the level of response appears to be modest. A previous exposure to rotavirus does not appear to limit the NSP4 response. Finally, our results suggest that NSP4 antibodies acquired after natural infection correlate with protection from rotavirus diarrhea.


    ACKNOWLEDGMENTS
 
This work was partially supported by Proyecto S1-2001000906 and Proyecto Iniciativa Científica del Milenio (FONACIT)—Ministerio de Ciencias y Tecnología—Venezuela, research grants DK30144 and DK56338 from the National Institutes of Health, and a grant from the Wellcome Trust.


    FOOTNOTES
 
* Corresponding author. Mailing address: Laboratorio de Biología de Virus, Centro de Microbiología y Biología Celular, Instituto Venezolano de Investigaciones Científicas (IVIC), Carretera Panamericana Km 11, Caracas, 1020-A, Edo Miranda, Venezuela. Phone: 58-212-5041882. Fax: 58-212-5041655. E-mail: evizzi{at}ivic.ve. Back

{dagger} Present address: Biologics—Clinical Research, Merck & Co., Inc., Blue Bell, PA 19422. Back

{ddagger} Present address: Department of Gastrointestinal Sciences, Christian Medical College, Vellore, India. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Au, K.-S., W.-K. Chan, J. W. Burns, and M. K. Estes. 1989. Receptor activity of rotavirus nonstructural glycoprotein NS28. J. Virol. 63:4553-4562.[Abstract/Free Full Text]
  2. Ball, J. M., P. Tian, C. Q. Zeng, A. P. Morris, and M. K. Estes. 1996. Age-dependent diarrhea induced by a rotaviral nonstructural glycoprotein. Science 272:101-104.[Abstract]
  3. Bertolotti-Ciarlet, A., M. Ciarlet, S. E. Crawford, M. Conner, and M. K. Estes. 2003. Immunogenicity and protective efficacy of rotavirus 2/6-virus-like particles produced by a dual baculovirus expression vector and administered intramuscularly, intranasally, or orally to mice. Vaccine 21: 3885-3900.[CrossRef][Medline]
  4. Boshuizen, J. A., J. H. J. Reimerink, A. M. Korteland-van Male, V. J. J. van Ham, M. P. G. Koopmans, H. A. Büller, J. Dekker, and A. W. C. Einerhand. 2003. Changes in small intestinal homeostasis, morphology, and gene expression during rotavirus infection of infant mice. J. Virol. 77: 13005-13016.[Abstract/Free Full Text]
  5. Burns, J. W., M. Siadat-Pajouh, A. A. Krishnaney, and H. B. Greenberg. 1996. Protective effect of rotavirus VP6-specific IgA monoclonal antibodies that lack neutralizing activity. Science 272:104-107.[Abstract]
  6. Cheng, S. C., E. F. Fynan, H. L. Robinson, S. Lu, H. B. Greenberg, J. C. Santoro, and J. E. Herrmann. 1997. Protective immunity induced by rotavirus DNA vaccines. Vaccine 15:899-902.[CrossRef][Medline]
  7. Chiba, S., T. Yokoyama, S. Nakata, Y. Morita, T. Urasawa, K. Taniguchi, S. Urasawa, and T. Nakao. 1986. Protective effect of naturally acquired homotypic and heterotypic rotavirus antibodies. Lancet ii:417-421.
  8. Ciarlet, M., F. Liprandi, M. E. Conner, and M. K. Estes. 2000. Species specificity and interspecies relatedness of NSP4 genetic groups by comparative NSP4 sequence analyses of animal rotaviruses. Arch. Virol. 145: 371-383.[CrossRef][Medline]
  9. Diepolder, H., R. Zachoval, R. Hoffman, E. Wierenga, T. Santantonio, M.-C. Jung, D. Eichenlaub, and G. Pape. 1995. Possible mechanism involving T-lymphocyte response to non-structural protein 3 in viral clearance in acute hepatitis C virus infection. Lancet 346:1006-1007.[CrossRef][Medline]
  10. Feng, N., P. T. Vo, D. Chung, T. P. Vo, Y. Hoshino, and H. B. Greenberg. 1997. Heterotypic protection following oral immunization with live heterologous rotavirus in a mouse model. J. Infect. Dis. 175:330-341.[Medline]
  11. Flores, J., I. Perez-Schael, M. Blanco, A. M. Rojas, E. Alfonzo, I. Crespo, W. Cunto, A. L. Pittman, and A. Z. Kapikian. 1993. Reactogenicity and immunogenicity of a high-titer rhesus rotavirus-based quadrivalent rotavirus vaccine. J. Clin. Microbiol. 31:2439-2445.[Abstract/Free Full Text]
  12. Hall, R., T. Brand, M. Lobigs, M. Y. Sangster, and M. Howard. 1996. Protective immune responses to the E and NS1 proteins of Murray Valley encephalitis virus in hybrids of flavivirus-resistant mice. J. Gen. Virol. 77:1287-1294.[Abstract/Free Full Text]
  13. Hjelt, K., P. C. Grauballe, A. Paerregard, O. H. Nielsen, and P. A. Krasilnikoff. 1987. Protective effect of preexisting rotavirus specific immunoglobulin A against naturally acquired rotavirus infection in children. J. Med. Virol. 21:39-47.[Medline]
  14. Ishida, S.-I., N. Feng, B. Tang, J. M. Gilbert, and H. B. Greenberg. 1996. Quantification of systemic and local immune responses to individual rotavirus proteins during rotavirus infection in mice. J. Clin. Microbiol. 34: 1694-1700.[Abstract]
  15. Ishida, S. I., N. Feng, J. M. Gilbert, B. Tang, and H. B. Greenberg. 1997. Immune responses to individual rotavirus proteins following heterologous and homologous rotavirus infection in mice. J. Infect. Dis. 175:1317-1323.[Medline]
  16. Jiang, B., J. R. Gentsch, and R. I. Glass. 2002. The role of serum antibodies in the protection against rotavirus disease: an overview. Clin. Infect. Dis. 34:1351-1361.[CrossRef][Medline]
  17. Johansen, K., J. Hinkula, F. Espinoza, M. Levi, C. Zeng, U. Ruden, T. Vesikari, M. Estes, and L. Svensson. 1999. Humoral and cell-mediated immune responses in humans to the NSP4 enterotoxin of rotavirus. J. Med. Virol. 59:369-377.[CrossRef][Medline]
  18. Kapikian, A. Z., R. J. Yolken, and H. B. Greenberg. 1979. Gastroenteritis viruses, p. 927-995. In E. H. Lennette and N. J. Schmidt (ed.), Diagnostic procedures for viral, rickettsial, and chlamydial infections, 5th ed. American Public Health Association, Washington, D.C.
  19. Liprandi, F., B. Brito, L. Palencia, and J. Esparza. 1986. Derivation of a monoclonal antibody against the group specific antigen of rotaviruses and its use in a diagnostic enzymatic immunoassay. Acta Cient. Venez. 37:432-436.[Medline]
  20. Mori, Y., M. A. Borgan, N. Ito, M. Sugiyama, and N. Minamoto. 2002. Sequential analysis of nonstructural protein NSP4s derived from group A avian rotaviruses. Virus Res. 89:145-151.[CrossRef][Medline]
  21. Murray, A. M., C. D. Kelly, S. S. Nussey, and A. P. Johnstone. 1998. Production of glutathione-coated microtitre plates for capturing recombinant glutathione S-transferase fusion proteins as antigens in immunoassays. J. Immunol. Methods 218:133-139.[CrossRef][Medline]
  22. O'Neal, C. M., S. E. Crawford, M. K. Estes, and M. E. Conner. 1997. Rotavirus virus-like particles administered mucosally induce protective immunity. J. Virol. 71:8707-8717.[Abstract]
  23. O'Ryan, M. L., D. O. Matson, M. K. Estes, and L. K. Pickering. 1994. Anti-rotavirus G type-specific and isotype-specific antibodies in children with natural rotavirus infections. J. Infect. Dis. 169:504-511.[Medline]
  24. Petrie, B. L., H. B. Greenberg, D. Y. Graham, and M. K. Estes. 1984. Ultrastructural localization of rotavirus antigens using colloidal gold. Virus Res. 1:133-152.[CrossRef][Medline]
  25. Ray, P., J. Malik, R. K. Singh, S. Bhatnagar, R. Bahl, R. Kumar, and M. K. Bhan. 2003. Rotavirus nonstructural protein NSP4 induces heterotypic antibody responses during natural infection in children. J. Infect. Dis. 187:1786-1793.[CrossRef][Medline]
  26. Richardsson, S. C., K. Grimwood, and R. Bishop. 1993. Analysis of homotypic and heterotypic serum immune responses to rotavirus proteins following primary rotavirus infection by using the radioimmunoprecipitation technique. J. Clin. Microbiol. 31:377-385.[Abstract/Free Full Text]
  27. Salinas, B., G. González, R. González, M. Escalona, M. Materan, and I. Pérez-Schael. 2004. Epidemiologic and clinical characteristics of rotavirus disease during five years of surveillance in Venezuela. Pediatr. Infect. Dis. J. 23(Suppl. 10):S161-S167.[Medline]
  28. Tian, P., Y. Hu, W. P. Schilling, D. A. Lindsay, J. Eiden, and M. K. Estes. 1994. The nonstructural glycoprotein of rotavirus affects intracellular calcium levels. J. Virol. 68:251-257.[Abstract/Free Full Text]
  29. Vesikari, T., E. Isolauri, A. Delem, E. D'Hondt, F. E. Andre, and G. Zissis. 1983. Immunogenicity and safety of live oral attenuated bovine rotavirus vaccine strain RIT 4237 in adults and young children. Lancet ii:807-811.
  30. Ward, R. L., M. N. McNeal, and J. F. Sheridan. 1992. Evidence that active protection following oral immunization of mice with live rotavirus is not dependent on neutralizing antibody. Virology 188:57-66.[CrossRef][Medline]
  31. Ward, R. L. 2003. Possible mechanisms of protection elicited by candidate rotavirus vaccines as determined with the adult mouse model. Viral Immunol. 16:17-24.[CrossRef][Medline]
  32. Yuan, L., S. Honma, S. Ishida, X. Y. Yan, A. Z. Kapikian, and Y. Hoshino. 2004. Species-specific but not genotype-specific primary and secondary isotype-specific NSP4 antibody responses in gnotobiotic calves and piglets infected with homologous host bovine (NSP4[A]) or porcine (NSP4[B]) rotavirus. Virology 330:92-104.[CrossRef][Medline]
  33. Yuan, L., S. Ishida, S. Honma, J. T. Patton, D. C. Hodgins, A. Z. Kapikian, and Y. Hoshino. 2004. Homotypic and heterotypic serum isotype-specific antibody responses to rotavirus nonstructural protein 4 and viral protein (VP) 4, VP6, and VP7 in infants who received selected live oral rotavirus vaccines. J. Infect. Dis. 189:1833-1845.[CrossRef][Medline]


Clinical and Diagnostic Laboratory Immunology, October 2005, p. 1157-1163, Vol. 12, No. 10
1071-412X/05/$08.00+0     doi:10.1128/CDLI.12.10.1157-1163.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vizzi, E.
Right arrow Articles by Ludert, J. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vizzi, E.
Right arrow Articles by Ludert, J. E.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Antimicrob. Agents Chemother. Clin. Microbiol. Rev. Infect. Immun.
J. Clin. Microbiol. J. Virol. ALL ASM JOURNALS